Use of synthetic peptides to locate novel integrin alpha(2)beta(1)-binding motifs in human collagen III

A set of 57 synthetic peptides encompassing the entire triple-helical domain of human collagen III was used to locate binding sites for the collagen-binding integrin alpha(2)beta(1). The capacity of the peptides to support Mg2+-dependent binding of several integrin preparations was examined. Wild-type integrins (recombinant alpha(2) I-domain, alpha(2)beta(1) purified from platelet membranes, and recombinant soluble alpha(2)beta(1) expressed as an alpha(2)-Fos/beta(1)-Jun heterodimer) bound well to only three peptides, two containing GXX'GER motifs (GROGER and GMOGER, where O is hydroxyproline) and one containing two adjacent GXX'GEN motifs (GLKGEN and GLOGEN). Two mutant alpha(2) I-domains were tested: the inactive T221A mutant, which recognized no peptides, and the constitutively active E318W mutant, which bound a larger subset of peptides. Adhesion of activated human platelets to GER-containing peptides was greater than that of resting platelets, and HT1080 cells bound well to more of the peptides compared with platelets. Binding of cells and recombinant proteins was abolished by anti-alpha(2) monoclonal antibody 6F1 and by chelation of Mg2+. We describe two novel high affinity integrin-binding motifs in human collagen III (GROGER and GLOGEN) and a third motif (GLKGEN) that displays intermediate activity. Each motif was verified using shorter synthetic peptides.

ICln, a novel integrin alpha(11b)beta3-associated protein, functionally regulates platelet activation.

A critical role for the conserved -integrin cytoplasmic motif, KVGFFKR, is recognized in the regulation of activation of the platelet integrin IIb3. To understand the molecular mechanisms of this regulation, we sought to determine the nature of the protein interactions with this cytoplasmic motif. We used a tagged synthetic peptide, biotin-KVGFFKR, to probe a high density protein expression array (37,200 recombinant human proteins) for high affinity interactions. A number of potential integrin-binding proteins were identified. One such protein, a chloride channel regulatory protein, ICln, was characterized further because its affinity for the integrin peptide was highest as was its expression in platelets. We verified the presence of ICln in human platelets by PCR, Western blots, immunohistochemistry, and its co-association with IIb3 by surface plasmon resonance. The affinity of this interaction was 82.2 ± 24.4 nM in a cell free assay. ICln co-immunoprecipitates with IIb3 in platelet lysates demonstrating that this interaction is physiologically relevant. Furthermore, immobilized KVGFFKR peptides, but not control KAAAAAR peptides, specifically extract ICln from platelet lysates. Acyclovir (100 µM to 5 mM), a pharmacological inhibitor of the ICln chloride channel, specifically inhibits integrin activation (PAC-1 expression) and platelet aggregation without affecting CD62 P expression confirming a specific role for ICln in integrin activation. In parallel, a cell-permeable peptide corresponding to the potential integrin-recognition domain on ICln (AKFEEE, 10–100 µM) also inhibits platelet function. Thus, we have identified, verified, and characterized a novel functional interaction between the platelet integrin and ICln, in the platelet membrane.

Interferon-induced transmembrane 3 binds osteopontin in vitro: expressed in vivo IFITM3 reduced OPN expression

Osteopontin is a secreted, integrin-binding and phosphorylated acidic glycoprotein, which has an important role in tumour progression. We have shown that Wnt, Ets, AP-1, c-jun and beta-catenin/Lef-1/Tcf-1 stimulates OPN transcription in rat mammary carcinoma cells by binding to a specific promoter sequence. However, co-repressors of OPN have not been identified. In this study, we have used the bacterial two-hybrid system to isolate cDNA-encoding proteins that bind to OPN and modulate its role in malignant transformation. Using this approach we isolated interferon-induced transmembrane protein 3 gene (IFITM3) as a potential protein partner. We show that IFITM3 and OPN interact in vitro and in vivo and that IFITM3 reduces osteopontin (OPN) mRNA expression, possibly by affecting OPN mRNA stability. Stable transfection of IFITM3 inhibits OPN, which mediates anchorage-independent growth, cell adhesion and cell invasion. Northern blot analysis revealed an inverse mRNA expression pattern of IFITM3 and OPN in human mammary cell lines. Inhibition of IFITM3 by antisense RNA promoted OPN protein expression, enhanced cell invasion by parental benign non-invasive Rama 37 cells, indicating that the two proteins interact functionally as well. We also identified an IFITM3 DNA-binding domain, which interacts with OPN, deletion of which abolished its inhibitive effect on OPN. This work has shown for the first time that IFITM3 physically interacts with OPN and reduces OPN mRNA expression, which mediates cell adhesion, cell invasion, colony formation in soft agar and metastasis in a rat model system. Oncogene (2010) 29, 752-762; doi: 10.1038/onc.2009.379; published online 9 November 2009

Characterization of a ligand-attenuated binding site on glycoprotein IIb/IIIa

We describe an epitope on the platelet integrin, GPIIb/IIIa, identified by the monoclonal antibody, 4F8, which is attenuated by small-molecule GPIIb/IIIa ligands. 4F8 did not bind to the ligand binding pocket as it did not compete with a radiolabelled antagonist, H-3-SC-52012. This indicates that the 4F8 epitope behaves as a ligand-attenuated binding site (LABS). Ligand-induced attenuation of 4178 was an active process as it was prevented by pretreating platelets with cytochalasin D and reduced by prostaglandin E-1 or inhibition of protein kinase C. Disappearance of the epitope was required for full platelet activation as 4F8 prevented platelet aggregation without inhibiting fibrinogen binding. These results suggest a model where disappearance of the 4F8 epitope is a secondary event required for full

Identification of high-affinity binding sites for the insulin sensitizer rosiglitazone (BRL-49653) in rodent and human adipocytes using a radioiodinated ligand for peroxisomal proliferator-activated receptor gamma.

A radioiodinated ligand, [125I]SB-236636 [(S)-(-)3-[4-[2-[N-(2-benzoxazolyl)-N-methylamino]ethoxy]3-[125I]iodophenyl]2-ethoxy propanoic acid], which is specific for the ? isoform of the peroxisomal proliferator activated receptor (PPAR?), was developed. [125I]SB-236636 binds with high affinity to full-length human recombinant PPAR?1 and to a GST (glutathione S-transferase) fusion protein contg. the ligand binding domain of human PPAR?1 (KD = 70 nM). Using this ligand, the authors characterized binding sites in adipose-derived cells from rat, mouse and humans. In competition expts., rosiglitazone (BRL-49653), a potent antihyperglycemic agent, binds with high affinity to sites in intact adipocytes (IC50 = 12, 4 and 9 nM for rat, 3T3-L1 and human adipocytes, resp.). Binding affinities (IC50) of other thiazolidinediones for the ligand binding domain of PPAR?1 were comparable with those detd. in adipocytes and reflected the rank order of potencies of these agents as stimulants of glucose transport in 3T3-L1 adipocytes and antihyperglycemic agents in vivo: rosiglitazone > pioglitazone > troglitazone. Competition of [125I]SB-236636 binding was stereoselective in that the IC50 value of SB-219994, the (S)-enantiomer of an ?-trifluoroethoxy propanoic acid insulin sensitizer, was 770-fold lower than that of SB-219993 [(R)-enantiomer] at recombinant human PPAR?1. The higher binding affinity of SB-219994 also was evident in intact adipocytes and reflected its 100-fold greater potency as an antidiabetic agent. The results strongly suggest that the high-affinity binding site for [125I]SB-236636 in intact adipocytes is PPAR? and that the pharmacol. of insulin-sensitizer binding in rodent and human adipocytes is very similar and, moreover, predictive of antihyperglycemic activity in vivo.

Validated ligand binding sites in CCK receptors. Next step: Computer aided design of novel CCK ligands

Computer-aided drug design becomes an important part of G-protein coupled receptors (GPCR) drug discovery process that is applied for improving the efficiency of derivation and optimization of novel ligands. It represents the combination of methods that-use-structural information of a receptor binding site of known ligands to design new ligands. In this report, we give a brief description of ligand binding sites in cholecystokinin and gastrin receptors (CK1R and CCK2R) which were delineated using experimental and computational methods, and then, we show how the validated ligand binding sites can be used to design and improve novel ligands. The translation of the knowledge of ligand-binding sites of different GPCRs to computer-aided design of novel ligands is summarized.

Molecular modeling of N-terminal domains of NMDA-receptor. Study of ligand binding with N-terminal domains

Using the molecular-graphic complex Sybyl6.7.2, computational construction of spatial models for N-terminal domains (of NR1- and NR2B-subunits) of NMDA-receptor was conducted. On the basis of the constructed models and also CoMFA method the conclusion is made about presence of the binding site for the compounds similar to iphenprodyl in two N-terminal domains of NR1- and NR2B-subunits. The obtained data can be used for constructing new ligands.

Locating binding poses in protein-ligand systems using reconnaissance metadynamics

A molecular dynamics-based protocol is proposed for finding and scoring protein-ligand binding poses. This protocol uses the recently developed reconnaissance metadynamics method, which employs a self-learning algorithm to construct a bias that pushes the system away from the kinetic traps where it would otherwise remain. The exploration of phase space with this algorithm is shown to be roughly six to eight times faster than unbiased molecular dynamics and is only limited by the time taken to diffuse about the surface of the protein. We apply this method to the well-studied trypsin-benzamidine system and show that we are able to refind all the poses obtained from a reference EADock blind docking calculation. These poses can be scored based on the length of time the system remains trapped in the pose. Alternatively, one can perform dimensionality reduction on the output trajectory and obtain a map of phase space that can be used in more expensive free-energy calculations.

Free fatty acid receptors:structural models and elucidation of ligand binding interactions

BACKGROUND: The free fatty acid receptors (FFAs), including FFA1 (orphan name: GPR40), FFA2 (GPR43) and FFA3 (GPR41) are G protein-coupled receptors (GPCRs) involved in energy and metabolic homeostasis. Understanding the structural basis of ligand binding at FFAs is an essential step toward designing potent and selective small molecule modulators.

RESULTS: We analyse earlier homology models of FFAs in light of the newly published FFA1 crystal structure co-crystallized with TAK-875, an ago-allosteric ligand, focusing on the architecture of the extracellular binding cavity and agonist-receptor interactions. The previous low-resolution homology models of FFAs were helpful in highlighting the location of the ligand binding site and the key residues for ligand anchoring. However, homology models were not accurate in establishing the nature of all ligand-receptor contacts and the precise ligand-binding mode. From analysis of structural models and mutagenesis, it appears that the position of helices 3, 4 and 5 is crucial in ligand docking. The FFA1-based homology models of FFA2 and FFA3 were constructed and used to compare the FFA subtypes. From docking studies we propose an alternative binding mode for orthosteric agonists at FFA1 and FFA2, involving the interhelical space between helices 4 and 5. This binding mode can explain mutagenesis results for residues at positions 4.56 and 5.42. The novel FFAs structural models highlight higher aromaticity of the FFA2 binding cavity and higher hydrophilicity of the FFA3 binding cavity. The role of the residues at the second extracellular loop used in mutagenesis is reanalysed. The third positively-charged residue in the binding cavity of FFAs, located in helix 2, is identified and predicted to coordinate allosteric modulators.

CONCLUSIONS: The novel structural models of FFAs provide information on specific modes of ligand binding at FFA subtypes and new suggestions for mutagenesis and ligand modification, guiding the development of novel orthosteric and allosteric chemical probes to validate the importance of FFAs in metabolic and inflammatory conditions. Using our FFA homology modelling experience, a strategy to model a GPCR, which is phylogenetically distant from GPCRs with the available crystal structures, is discussed.

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Interactions of 1-Methylimidazole with UO2(CH3CO2)2 and UO2(NO3)2: Structural, Spectroscopic and Theoretical Evidence for Imidazole Binding to the Uranyl Ion

The first definitive high-resolution single-crystal X-ray structure for the coordination of the 1-methylimidazole (Meimid) ligand to UO2(Ac)2 (Ac = CH3CO2) is reported. The crystal structure evidence is confirmed by IR, Raman, and UV-vis spectroscopic data. Direct participation of the nitrogen atom of the Meimid ligand in binding to the uranium center is confirmed. Structural analysis at the DFT (B3LYP) level of theory showed a conformational difference of the Meimid ligand in the free gas-phase complex versus the solid state due to small energetic differences and crystal packing effects. Energetic analysis at the MP2 level in the gas phase supported stronger Meimid binding over H2O binding to both UO2(Ac)2 and UO2(NO3)2. In addition, self-consistent reaction field COSMO calculations were used to assess the aqueous phase energetics of combination and displacement reactions involving H2O and Meimid ligands to UO2R2 (R = Ac, NO3). For both UO2(NO3)2 and UO2(Ac)2, the displacement of H2O by Meimid was predicted to be energetically favorable, consistent with experimental results that suggest Meimid may bind uranyl at physiological pH. Also, log(Knitrate/KAc) calculations supported experimental evidence that the binding stoichiometry of the Meimid ligand is dependent upon the nature of the reactant uranyl complex. These results clearly demonstrate that imidazole binds to uranyl and suggest that binding of histidine residues to uranyl could occur under normal biological conditions.

Formation of Novel Di-Nuclear Lanthanide Luminescent Sm(III), Eu(III) and Tb(III) Triple Stranded Helicates from a C2 Symmetrically 2,6-Dicarboxylic Amide based 1,3-Xylene Ligand in CH3CN

The synthesis of the C2-symmetrical ligand 1 consisting of two naphthalene units connected to two pyridine-2,6-dicarboxamide moieties linked by a xylene spacer and the formation of LnIII-based (Ln1/4 Sm, Eu, Tb, and Lu) dimetallic helicates [Ln2 · 13] in MeCN by means of a metal-directed synthesis is described. By analyzing the metal-induced changes in the absorption and the fluorescence of 1, the formation of the helicates, and the presence of a second species [Ln2 · 12] was confirmed by nonlinear- regression analysis. While significant changes were observed in the photophysical properties of 1, the most dramatic changes were observed in the metal-centred lanthanide emissions, upon excitation of the naphthalene antennae. From the changes in the lanthanide emission, we were able to demonstrate that these helicates were formed in high yields (ca. 90% after the addition of 0.6 equiv. of LnIII), with high binding constants, which matched well with that determined from the changes in the absorption spectra. The formation of the LuIII helicate, [ Lu2 · 13 ] , was also investigated for comparison purposes, as we were unable to obtain accurate binding constants from the changes in the fluorescence emission upon formation of [Sm2 · 13], [Eu2 · 13], and [Tb2 · 13].

Identification of Determinants of Glucose-Dependent Insulinotropic Polypeptide Receptor That Interact with N-Terminal Biologically Active Region of the Natural Ligand

Glucose-dependent insulinotropic polypeptide receptor (GIPR), a member of family B of the G-protein coupled receptors, is a potential therapeutic target for which discovery of nonpeptide ligands is highly desirable. Structure-activity relationship studies indicated that the N-terminal part of glucose-dependent insulinotropic polypeptide (GIP) is crucial for biological activity. Here, we aimed at identification of residues in the GIPR involved in functional interaction with N-terminal moiety of GIP. A homology model of the transmembrane core of GIPR was constructed, whereas a three-dimensional model of the complex formed between GIP and the N-terminal extracellular domain of GIPR was taken from the crystal structure. The latter complex was docked to the transmembrane domains of GIPR, allowing in silico identification of putative residues of the agonist binding/activation site. All mutants were expressed at the surface of human embryonic kidney 293 cells as indicated by flow cytometry and confocal microscopy analysis of fluorescent GIP binding. Mutation of residues Arg183, Arg190, Arg300, and Phe357 caused shifts of 76-, 71-, 42-, and 16-fold in the potency to induce cAMP formation, respectively. Further characterization of these mutants, including tests with alanine-substituted GIP analogs, were in agreement with interaction of Glu3 in GIP with Arg183 in GIPR. Furthermore, they strongly supported a binding mode of GIP to GIPR in which the N-terminal moiety of GIP was sited within transmembrane helices (TMH) 2, 3, 5, and 6 with biologically crucial Tyr1 interacting with Gln224 (TMH3), Arg300 (TMH5), and Phe357 (TMH6). These data represent an important step toward understanding activation of GIPR by GIP, which should facilitate the rational design of therapeutic agents.