210 resultados para Dahlia Morgan


Relevância:

10.00% 10.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

CD33 is a member of the sialic acid–binding immunoglobulin-like lectin (Siglec) family of inhibitory receptors and a therapeutic target for acute myeloid leukemia (AML). CD33 contains a cytoplasmic immunoreceptor tyrosine-based inhibitory motif (ITIM), which can recruit SHP-1 and SHP-2. How CD33 expression is regulated is unclear. Suppressor of cytokine signaling 3 (SOCS3) is expressed in response to cytokines, LPS, and other PAMPs, and competes with SHP-1/2 binding to ITIMs of cytokine receptors, thereby inhibiting signaling. In this study, using peptide pull-down experiments, we found that SOCS3 can specifically bind to the phosphorylated ITIM of CD33. Additionally, following cross-linking SOCS3 can recruit the ECS E3 ligase resulting in accelerated proteasomal degradation of both CD33 and SOCS3. Our data suggest that the tyrosine motifs in CD33 are not important for internalization, while they are required for degradation. Moreover, SOCS3 inhibited the CD33-induced block on cytokine-induced proliferation. This is the first receptor shown to be degraded by SOCS3 and where SOCS3 and its target protein are degraded concomitantly. Our findings clearly suggest that during an inflammatory response, the inhibitory receptor CD33 is lost by this mechanism. Moreover, this has important clinical implications as tumors expressing SOCS3 may be refractory to -CD33 therapy.

Relevância:

10.00% 10.00%

Publicador:

Relevância:

10.00% 10.00%

Publicador:

Resumo:

CD33-related Siglecs (sialic acid-binding immunoglobulin-like lectins) 5–11 are inhibitory receptors that contain a membrane proximal ITIM (immunoreceptor tyrosine-based inhibitory motif) (I/V/L/)XYXX(L/V), which can recruit SHP-1/2. However, little is known about the regulation of these receptors. SOCS3 (suppressor of cytokine signaling 3) is up-regulated during inflammation and competes with SHP-1/2 for binding to ITIM-like motifs on various cytokine receptors resulting in inhibition of signaling. We show that SOCS3 binds the phosphorylated ITIM of Siglec 7 and targets it for proteasomal-mediated degradation, suggesting that Siglec 7 is a novel SOCS target. Following ligation, the ECS E3 ligase is recruited by SOCS3 to target Siglec 7 for proteasomal degradation, and SOCS3 expression is decreased concomitantly. In addition, we found that SOCS3 expression blocks Siglec 7-mediated inhibition of cytokine-induced proliferation. This is the first time that a SOCS target has been reported to degrade simultaneously with the SOCS protein and that inhibitory receptors have been shown to be degraded in this way. This may be a mechanism by which the inflammatory response is potentiated during infection.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Polymerase chain reaction (PCR) assessment of clonal immunoglobulin (Ig) and T-cell receptor (TCR) gene rearrangements is an important diagnostic tool in mature B-cell neoplasms. However, lack of standardized PCR protocols resulting in a high level of false negativity has hampered comparability of data in previous clonality studies. In order to address these problems, 22 European laboratories investigated the Ig/TCR rearrangement patterns as well as t(14;18) and t(11;14) translocations of 369 B-cell malignancies belonging to five WHO-defined entities using the standardized BIOMED-2 multiplex PCR tubes accompanied by international pathology panel review. B-cell clonality was detected by combined use of the IGH and IGK multiplex PCR assays in all 260 definitive cases of B-cell chronic lymphocytic leukemia (n¼56), mantle cell lymphoma (n¼54), marginal zone lymphoma (n¼41) and follicular lymphoma (n¼109). Two of 109 cases of diffuse large B-cell lymphoma showed no detectable clonal marker. The use of these techniques to assign cell lineage should be treated with caution as additional clonal TCR gene rearrangements were frequently detected in all disease categories. Our study indicates that the BIOMED-2 multiplex PCR assays provide a powerful strategy for clonality assessment in B-cell malignancies resulting in high Ig clonality detection rates particularly when IGH and IGK strategies are combined.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

An experimental investigation of the argon plasma behavior near the E-H transition in an inductively coupled Gaseous Electronics Conference reference cell is reported. Electron density and temperature, ion density, argon metastable density, and optical emission measurements have been made as function of input power and gas pressure. When plotted versus plasma power, applied power corrected for coil and hardware losses, no hysteresis is observed in the measured plasma parameter dependence at the E-H mode transition. This suggests that hysteresis in the E-H mode transition is due to ignoring inherent power loss, primarily in the matching system.