Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Detection of a single DNA base-pair mismatch using an anthracene-tagged fluorescent probe

A novel anthracene-tagged oligonucleotide can discriminate between a fully-matched DNA target sequence and one with a single mismatching base-pair through a remarkable difference in fluorescence emission intensity upon duplex formation.

Biochemical characterization of the equine arteritis virus helicase suggests a close functional relationship between arterivirus and coronavirus helicases.

The arterivirus equine arteritis virus nonstructural protein 10 (nsp10) has previously been predicted to contain a Zn finger structure linked to a superfamily 1 (SF1) helicase domain. A recombinant form of nsp10, MBP-nsp10, was produced in Escherichia coli as a fusion protein with the maltose-binding protein. The protein was partially purified by affinity chromatography and shown to have ATPase activity that was strongly stimulated by poly(dT), poly(U), and poly(dA) but not by poly(G). The protein also had both RNA and DNA duplex-unwinding activities that required the presence of 5' single-stranded regions on the partial-duplex substrates, indicating a 5'-to-3' polarity in the unwinding reaction. Results of this study suggest a close functional relationship between the arterivirus nsp10 and the coronavirus helicase, for which NTPase and duplex-unwinding activities were recently demonstrated. In a number of biochemical properties, both arterivirus and coronavirus SF1 helicases differ significantly from the previously characterized RNA virus SF1 and SF2 enzymes. Thus, the combined data strongly support the idea that nidovirus helicases may represent a separate group of RNA virus-encoded helicases with distinct properties.

The design and performance of a 2.5-GHz telecommand link for wireless biomedical monitoring

This paper details the implementation and operational performance of a minimum-power 2.45-GHz pulse receiver and a companion on-off keyed transmitter for use in a semi-active duplex RF biomedical transponder. A 50-Ohm microstrip stub-matched zero-bias diode detector forms the heart of a body-worn receiver that has a CMOS baseband amplifier consuming 20 microamps from +3 V and achieves a tangential sensitivity of -53 dBm. The base transmitter generates 0.5 W of peak RF output power into 50 Ohms. Both linear and right-hand circularly polarized Tx-Rx antenna sets were employed in system reliability trials carried out in a hospital Coronary Care Unit, For transmitting antenna heights between 0.3 and 2.2 m above floor level, transponder interrogations were 95% reliable within the 67-m-sq area of the ward, falling to an average of 46 % in the surrounding rooms and corridors. Overall, the circular antenna set gave the higher reliability and lower propagation power decay index.

Rational Design of Acridine-Based Ligands with Selectivity for Human Telomeric Quadruplexes

Structure-based modeling methods have been used to design a series of disubstituted triazole-linked acridine compounds with selectivity for human telomeric quadruplex DNAs. A focused library of these compounds was prepared using click chemistry and the selectivity concept was validated against two promoter quadruplexes from the c-kit gene with known molecular structures, as well as with duplex DNA using a FRET-based melting method. Lead compounds were found to have reduced effects on the thermal stability of the c-kit quadruplexes and duplex DNA structures. These effects were further explored with a series of competition experiments, which confirmed that binding to duplex DNA is very low even at high duplex:telomeric quadruplex ratios. Selectivity to the c-kit quadruplexes is more complex, with some evidence of their stabilization at increasing excess over human telomeric quadruplex DNA. Selectivity is a result of the dimensions of the triazole-acridine compounds; and in particular the separation of the two alkyl-amino terminal groups. Both lead compounds also have selective inhibitory effects on the proliferation of cancer cell lines compared to a normal cell line, and one has been shown to inhibit the activity of the telomerase enzyme, which is selectively expressed in tumor cells, where it plays a role in maintaining telomere integrity and cellular immortalization.

Bis-guanylhydrazone diimidazo[1,2-a:1,2-c]pyrimidine as a novel and specific G-quadruplex binding motif

A bis-guanylhydrazone derivative of diimidazo[1,2-a:1,2-c]pyrimidine has unexpectedly been found to be a potent stabiliser of several quadruplex DNAs, whereas there is no significant interaction with duplex DNA. Molecular modeling suggests that the guanylhydrazone groups play an active role in quadruplex binding.

Biaryl polyamides as a new class of DNA quadruplex-binding ligands

We report a novel class of biaryl polyamides highly selective for G-quadruplex DNA, and with significant cytotoxicity in several cancer cell lines; they form planar U-shaped structures that match the surface area dimensions of a terminal G-quartet in quadruplex structures rather than the grooves of duplex DNA.

Targeting telomerase and telomeres: a click chemistry approach towards highly selective G-quadruplex ligands.

Maintenance of telomeres—specialized complexes that protect the ends of chromosomes, is undertaken by the enzyme complex telomerase, which is a key factor that is activated in more than 80% of cancer cells, but is absent in most normal cells. Targeting telomere maintenance mechanisms could potentially halt tumour growth across a broad spectrum of cancer types, with little cytotoxic effect outside cancer cells. Here, we describe in detail a new class of G-quadruplex binding ligands synthesized using a click chemistry approach. These ligands comprise a 1,3-di(1,2,3-triazol-4-yl)benzene pharmacophore, and display high levels of selectivity for interaction with G-quadruplex DNA vs. duplex DNA. The ability of these ligands to inhibit the enzymatic activity of telomerase correlates with their ability to stabilize quadruplex DNA, and with estimates of affinity calculated by molecular modeling.

Anthracene-modified oligonucleotides as fluorescent DNA mismatch sensors: discrimination between various base-pair mismatches

A fluorescent anthracene-tagged DNA probe has been shown to respond to various DNA sequences by changes to its emission signal upon duplex formation. The fluorescence response for duplexes containing a single mismatch near the anthracene site has been found to be very sensitive to its composition, with the emission signal increasing for a CA mismatch and decreasing for CT and CC mismatches.

The triazatruxene derivative azatrux binds to the parallel form of the human telomeric G-quadruplex under molecular crowding conditions: Biophysical and molecular modeling studies

The present study has employed a combination of spectroscopic, calorimetric and computational methods to explore the binding of the three side-chained triazatruxene derivative, termed azatrux, to a human telomeric G-quadruplex sequence, under conditions of molecular crowding. The binding of azatrux to the tetramolecular parallel [d(TGGGGT)](4) quadruplex in the presence and absence of crowding conditions, was also characterized. The data indicate that azatrux binds in an end-stacking mode to the parallel G-quadruplex scaffold and highlights the key structural elements involved in the binding. The selectivity of azatrux for the human telomeric G-quadruplex relative to another biologically relevant G-quadruplex (c-Kit87up) and to duplex DNA was also investigated under molecular crowding conditions, showing that azatrux has good selectivity for the human telomeric G-quadruplex over the other investigated DNA structures. (C) 2011 Elsevier Masson SAS. All rights reserved.

A structural analysis of G-quadruplex/ligand interactions

This focused review article discusses in detail, all available high-resolution small molecule ligand/G-quadruplex structural data derived from crystallographic and NMR based techniques, in an attempt to understand key factors in ligand binding and to highlight the biological importance of these complexes. In contrast to duplex DNA, G-quadruplexes are four-stranded nucleic acid structures folded from guanine rich repeat sequences stabilized by the stacking of guanine G-quartets and extensive Watson-Crick/Hoogsteen hydrogen bonding. Thermally stable, these topologies can play a role in telomere regulation and gene expression. The core structures of G-quadruplexes form stable scaffolds while the loops have been shown, by the addition of small molecule ligands, to be sufficiently adaptable to generate new and extended binding platforms for ligands to associate, either by extending G-quartet surfaces or by forming additional planar dinucleotide pairings. Many of these structurally characterised loop rearrangements were totally unexpected opening up new opportunities for the design of selective ligands. However these rearrangements do significantly complicate attempts to rationally design ligands against well defined but unbound topologies, as seen for the series of napthalene diimides complexes. Drawing together previous findings and with the introduction of two new crystallographic quadruplex/ligand structures we aim to expand the understanding of possible structural adaptations available to quadruplexes in the presence of ligands, thereby aiding in the design of new selective entities. (C) 2011 Elsevier Masson SAS. All rights reserved.

Sequence-Specific and Strand-Specific Cleavage In Oligodeoxyribonucleotides and DNA Containing 3'-Thiothymidine

Oligonucleotides containing a 3'-thiothymidine residue (T3's) at the cleavage site for the EcoRV restriction endonuclease (between the central T and A residues of the sequence GATATC) have been prepared on an automated DNA synthesizer using 5'-O-monomethoxytritylthymidine 3'-S-(2-cyanoethyl N,N-di-isopropylphosphorothioamidite). The self-complementary sequence GACGAT3'sATCGTC was completely resistant to cleavage by EcoRV, while the heteroduplex composed of 5'-TCTGAT3'sATCCTC and 5'-GAGGATATCAGA (duplex 4) was cleaved only in the unmodified strand (5'-GAGGATATCAGA). In contrast, strands containing a 3'-S-phosphorothiolate linkage could be chemically cleaved specifically at this site with Ag+. A T3's residue has also been incorporated in the (-) strand of double-stranded closed circular (RF IV) M13mp18 DNA at the cleavage site of a unique EcoRV recognition sequence by using 5'-pCGAGCTCGAT3'sATCGTAAT as a primer for polymerization on the template (+) strand of M13mp18 DNA. On treatment of this substrate with EcoRV, only one strand was cleaved to produce the RF II or nicked DNA. Taken in conjunction with the cleavage studies on the oligonucleotides, this result demonstrates that the 3'-S-phosphorothiolate linkage is resistant to scission by EcoRV. Additionally, the phosphorothiolate-containing strand of the M13mp18 DNA could be cleaved specifically at the point of modification using iodine in aqueous pyridine. The combination of enzymatic and chemical techniques provides, for the first time, a demonstrated method for the sequence-specific cleavage of either the (+) or (-) strand.

Low-power radio telemetry: the potential for remote patient monitoring

Radio-based signalling devices will play an important role in future generations of remote patient monitoring equipment, both at home and in hospital. Ultimately, it will be possible to sample vital signs frompatients, whatever their location and without them necessarily being aware that a measurement is being taken. This paper reviews currentmethods for the transmission by radio of physiological parameters over ranges of 0.3, 3 and 30 m, and describes the radiofrequency hardware required and the carrier frequencies commonly used. Future developments, including full duplex systems and the use of more advanced modulation schemes, are described. The paper concludeswith a case studyof a humantemperature telemeter built to indicateovulation. Clinical results clearly show the advantage to be had in adopting radio biotelemetry in this instance.

Photocontrolled Binding and Binding-Controlled Photochromism within Anthracene-Modified DNA

Modified DNA strands undergo a reversible light-induced reaction involving the intramolecular photodimerization of two appended anthracene tags. The photodimers exhibit markedly different binding behavior toward a complementary strand that depends on the number of bases between the modified positions. By preforming the duplex, photochromism can be suppressed, illustrating dual-mode gated behavior.

Detection of single nucleotide polymorphisms within a sequence of a gene associated with prostate cancer using a fluorophore-tagged DNA probe

Single nucleotide polymorphisms within a sequence of a gene associated with prostate cancer were identified using oligodeoxynucleotide probe sequences bearing internal anthracene fluorophores proximal to the SNP site. Depending upon the nature of the synthesised target sequences, probe-target duplex formation could lead to enhanced or attenuated fluorescence emission from the anthracene, enabling detection of a proximal base-pair as either matching or mismatching. © 2011 Elsevier Ltd. All rights reserved.