50 resultados para BIS(IMINO)PYRIDYL IRON(II)


Relevância:

40.00% 40.00%

Publicador:

Resumo:

Ionic liquids have been used to support a range of magnesium-and copper-based bis(oxazoline) complexes for the enantioselective Diels-Alder reaction between N-acryloyloxazolidinone and cyclopentadiene. Compared with reaction performed in dichloromethane or diethyl ether, an enhancement in ee is observed with a large increase in reaction rate. In addition, for non-sterically hindered bis(oxazoline) ligands, that is, phenyl functionalised ligands, a reversal in configuration is found in the ionic liquid, 1-ethyl-3-methylimidazolium bis[(trifluoromethanesulfonyl)imide], compared with molecular solvents. Supported ionic liquid phase catalysts have also been developed using surface-modified silica which show good reactivity and enantioselectivity for the case of the magnesium-based bis(oxazoline) complexes. Poor ees and conversion were observed for the analogous copper-based systems. Some drop in ee was found on supporting the catalyst due a drop in the rate of reaction and, therefore, an increase in the contribution from the uncatalysed a chiral reaction.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Single crystals of mercuric bis(N-imino-methyl-formamidate), Hg(Imf)(2), were obtained from aqueous solutions of 1,2,4-triazole and Hg(NO3)(2)center dot 2H(2)O. The crystal structure [monoclinic, P2(1)/c (no. 14), a = 499.6(2), b = 1051.2(4), c = 711.1(3) pm, beta = 117.55(1)degrees, Z = 2, R, for 890 reflections with I-0 > 2 sigma(I-0): 0.0369] contains linear centrosymmetric Hg(Imf)(2) molecules with Hg-N distances of only 203.5(7)pm. Two plus two intra- and intermolecular nitrogen atoms add to an effective coordination number of 6.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Colourless single crystals of [Hg(CF3)(2)(Pur)](4) and [Hg(CF3)(2)(Dat)](2) were obtained from aqueous and etheric solutions of the respective components Purine, (imidazo[4,5-d]pyrimidine, Pur), 3,5-dimethyl-4 '-amino-triazole (Dat) and bis(trifluoromethyl)mercury(II), Hg(CF3)(2). [Hg(CF3)(2)(Pur)](4) crystallizes with the tetragonal system (P-4, Z = 8, a = 1486.8(2), c = 1026.2(l) pm, R-all = 0.0657) with tetrameric molecules consisting of four purine molecules bridged by slightly bent Hg(CF3)2 molecules forming a cage with the CF3 ligands surrounding this cage. The two modifications of [Hg(Dat)(CF3)2]2 (1: 170 K, triclinic, P-1, Z = 2, a 814.9(2), b = 845.4(2), c = 968.4(3) pm, alpha = 106.55(2)degrees, beta= 103.41(2)degrees, gamma = 110.79(2)degrees, R-all = 0.1189; II: monoclinic, P2(1)/c, Z = 8, a = 879.8(2), b = 1731.0(3), c = 1593.9(3) pm, beta = 106.89(2)degrees, R-all = 0.1199) both contain dimeric molecules that are stacked parallel to one crystal axis to strands which are arranged in a parallel fashion in I and rotated against each other in 11 by 110 degrees. In both, the tetrameric [Hg(CF3)(2)(Pur)](4) and the dimeric [Hg(CF3)(2)(Dat)](2) the Hg(CF3)(2) molecules are slightly bent (around 167 and 170 degrees) and rather weakly attached to the N-donor ligands Pur and Dat with Hg-N distances around 272 pm, although in both cases the Hg atoms bridge between two ligand molecules.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Bu4N)(2)[Hg4I10] is the first compound for which tetranuclear anions [Hg4I10](2-) are observed in its crystal structure. Charge balance is achieved by ordered [Bu4N](+) cations.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

A series of bis(oxazoline) metal(II) complexes has been supported on silica and carbon supports by non-covalent immobilisation using an ionic liquid. The catalytic performance of these solids was compared for the enantioselective Diels-Alder reaction between N-acryloyloxazolidinone and cyclopentadiene and the Mukaiyama-aldol reaction between methyl pyruvate and 1-methoxy-1-trimethylsilyloxy-propene. In both reactions the enantioselectivity was strongly influenced by the choice of support displaying enantioselectivies (ee values) up to 40% higher than those conducted under homogeneous reaction conditions.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

Two novel alkynyl-bridged symmetric bis-tridentate ligands 1,2-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]-ferrocenyl)ethyne (3a; tpy-Fc-C C-Fc-tpy; Fc = ferrocenyl; tpy = terpyridyl) and 1,4-bis(1'-[4'-(2,2':6', 2 ''-terpyridinyl)]ferrocenyl)-1,3-butadiyne (3b; tpy-Fc-C C-C C-Fc-tpy) and their Ru2+ complexes 6a and 6b have been synthesized and characterized by cyclic voltammetry, UV-vis and luminescence spectroscopy, and in the case of 3b by single-crystal X-ray diffraction. Cyclic voltammograms of both compounds, 3a and 3b, display two severely overlapping ferrocene-based oxidative peaks with only one reductive peak. The redox behavior of 6a and 6b is dominated by the Ru2+/Ru3+ redox couple (E-1/2 from 1.33 to 1.34 V), the Fe2+/Fe3+ redox couples (E-1/2 from 0.46 to 0.80 V), and the tpy/tpy(-)/tpy(2-)redox couples (E-1/2 from -1.19 to -1.48 V). The UV-vis spectra of 6a and 6b show absorption bands assigned to the (1)[(d(pi)(Fe))(6)] -> (1)[(d(pi)(Fe))(5)(pi*(Ru)(tpy))(1)] MMLCT transition at similar to 555 nm. Complexes 6a and 6b are luminescent in H2O-CH3CN (4 : 1, v/v) solution at room temperature, and 6b exhibits the strongest luminescence intensity (lambda(em)(max): 710 nm, Phi(em): 2.28 x 10(-4), tau: 358 ns) relative to analogous ferrocene-based bis(terpyridine) Ru(II) complexes reported so far.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The asymmetric Diels-Alder reaction between N-acryloyloxazolidinone and cyclopentadiene and the Mukaiyama-aldol reaction between methylpyruvate and 1-phenyl-1-trimethylsilyloxyethene have been catalysed by heterogeneous copper(II)-bis(oxazoline)-based polymer immobilised ionic liquid phase (PIILP) systems generated from a range of linear and cross linked ionic polymers. In both reactions selectivity and ee were strongly influenced by the choice of polymer. A comparison of the performance of a range of Cu(II)-bis(oxazoline)-PIILP catalyst systems against analogous supported ionic liquid phase (SILP) heterogeneous catalysts as well as their homogeneous counterparts has been undertaken and their relative merits evaluated.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The title compound, [Ni2Cl2(C9H10NO2)(2)]center dot CH3OH, is a dinuclear unit built up by two nickel(II) complexes, bridged by two Cl atoms. The coordination geometry around each Ni-II atom can be considered as distorted square-pyramidal, with the tridendate chelate Schiff base ligands coordinating in a trans conformation through their imine N atom and phenoxy and alkoxy O atoms.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

In [Hg2I4(Pyp)] (Pyp = pyrazine, C4H4N2), centrosymmetric molecules consist of two HgI2 units connected by a pyrazine molecule.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The structure of (Et4N)(2)[Hg2Br6] contains dinuclear [Hg2Br6](2-) species as isolated anions. Charge balance is achieved by ordered [Et4N](+) cations. An inversion centre is located at the centre of the [Hg2Br6](2-) unit.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The Ni-II centre in the cation of the title compound, [Ni(C6H12S3)(2)]Br-2. 4H(2)O, occupies a crystallographic inversion centre and is octahedrally coordinated by six S-donors from two [9]aneS(3) ligands. Ni-S distances range from 2.3749 (16) to 2.4077 (15) Angstrom and S-Ni-S angles where both thia donors belong to the same ligand lie in a narrow range between 88.09 (5) and 88.67 (6)degrees. The water molecules participate in extensive hydrogen bonding with each other and with the Br- anions to form double chains with eight- and 12-membered hydrogen-bonded rings running along the crystallographic a direction.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Received for publication October 31, 2002. Design and operation of Fe0 permeable reactive barriers (PRBs) can be improved by understanding the long-term mineralogical transformations that occur within PRBs. Changes in mineral precipitates, cementation, and corrosion of Fe0 filings within an in situ pilot-scale PRB were examined after the first 30 months of operation and compared with results of a previous study of the PRB conducted 15 months earlier using X-ray diffraction and scanning electron microscopy employing energy dispersive X-ray and backscatter electron analyses. Iron (oxy)hydroxides, aragonite, and maghemite and/or magnetite occurred throughout the cores collected 30 mo after installation. Goethite, lepidocrocite, mackinawite, aragonite, calcite, and siderite were associated with oxidized and cemented areas, while green rusts were detected in more reduced zones. Basic differences from our last detailed investigation include (i) mackinawite crystallized from amorphous FeS, (ii) aragonite transformed into calcite, (iii) akaganeite transformed to goethite and lepidocrocite, (iv) iron (oxy)hydroxides and calcium and iron carbonate minerals increased, (v) cementation was greater in the more recent study, and (vi) oxidation, corrosion, and disintegration of Fe0 filings were greater, especially in cemented areas, in the more recent study. If the degree of corrosion and cementation that was observed from 15 to 30 mo after installation continues, certain portions of the PRB (i.e., up-gradient entrance of the ground water to the Fe0 section of the PRB) may last less than five more years, thus reducing the effectiveness of the PRB to mitigate contaminants. Abbreviations: EDX, energy dispersive X-ray • Fe0, zerovalent iron • PRB, permeable reactive barrier • SEM, scanning electron microscopy • XRD, X-ray diffraction

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Permeable reactive barriers (PRBs) of zero-valent iron (Fe0) are increasingly being used to remediate contaminated ground water. Corrosion of Fe0 filings and the formation of precipitates can occur when the PRB material comes in contact with ground water and may reduce the lifespan and effectiveness of the barrier. At present, there are no routine procedures for preparing and analyzing the mineral precipitates from Fe0 PRB material. These procedures are needed because mineralogical composition of corrosion products used to interpret the barrier processes can change with iron oxidation and sample preparation. The objectives of this study were (i) to investigate a method of preparing Fe0 reactive barrier material for mineralogical analysis by X-ray diffraction (XRD), and (ii) to identify Fe mineral phases and rates of transformations induced by different mineralogical preparation techniques. Materials from an in situ Fe0 PRB were collected by undisturbed coring and processed for XRD analysis after different times since sampling for three size fractions and by various drying treatments. We found that whole-sample preparation for analysis was necessary because mineral precipitates occurred within the PRB material in different size fractions of the samples. Green rusts quickly disappeared from acetone-dried samples and were not present in air-dried and oven-dried samples. Maghemite/magnetite content increased over time and in oven-dried samples, especially after heating to 105°C. We conclude that care must be taken during sample preparation of Fe0 PRB material, especially for detection of green rusts, to ensure accurate identification of minerals present within the barrier system.