Sequence-dependent molecular conformation of polynucleotides: right and left-handed helices

Based upon a stereochemical guideline, two topologically distinct types of helicalduplexes have been deduced for a polynucleotide duplex with alternating purine pyrimidine sequence (PAPP): (a) right-handed uniform (RU) helix and (b) left-handed zig-zag (LZ) helix. Both structures have trinucleoside diphosphate as the basic unit wherein the purine pyrimidine fragment has a different conformation from the pyrimidine-purine fragment. Thus, RU and LZ helices represent two different classes of sequence-dependent molecular conformations for PAPP. The conformationalf eatures of an RU helix of PAPP in B-form and three LZ-helices for B-, D- and Z-forms are discussed.

Modified design procedure for a sparger reactor sequence

In an earlier communication[l] we have indicated a general graphical design procedure for a sequence of sparger reactors in which a second order liquid phase reaction proceeds in a stagewise fashion. The prediction of the reactant concentration in each stage and hence the conversion depended on a search procedure initiated along a straight line representing the mass balance equation at the given stage and drawn from the known feed stage located on the abscissa in a E-IU diagram for the given system.

Variability of Indian summer monsoon rainfall in daily data from gauge and satellite

It has long been thought that tropical rainfall retrievals from satellites have large errors. Here we show, using a new daily 1 degree gridded rainfall data set based on about 1800 gauges from the India Meteorology Department (IMD), that modern satellite estimates are reasonably close to observed rainfall over the Indian monsoon region. Daily satellite rainfalls from the Global Precipitation Climatology Project (GPCP 1DD) and the Tropical Rainfall Measuring Mission (TRMM) Multisatellite Precipitation Analysis (TMPA) are available since 1998. The high summer monsoon (June-September) rain over the Western Ghats and Himalayan foothills is captured in TMPA data. Away from hilly regions, the seasonal mean and intraseasonal variability of rainfall (averaged over regions of a few hundred kilometers linear dimension) from both satellite products are about 15% of observations. Satellite data generally underestimate both the mean and variability of rain, but the phase of intraseasonal variations is accurate. On synoptic timescales, TMPA gives reasonable depiction of the pattern and intensity of torrential rain from individual monsoon low-pressure systems and depressions. A pronounced biennial oscillation of seasonal total central India rain is seen in all three data sets, with GPCP 1DD being closest to IMD observations. The new satellite data are a promising resource for the study of tropical rainfall variability.

Sequence of reactions leading to cytochrome-p-450 synthesis-effect of drugs

The effect of phenobarbital on the rates of the synthesis of the protein and heme moieties of cytochrome P-450 has been studied. For this purpose, cytochrome P-450 has been partially purified as its P-420 derivative and the labeled amino acid incorporation into the protein has been studied after subjecting a partially purified preparation to sodium dodecyl sulfate gel electrophoresis. The incorporation studies into the protein species after sodium dodecyl sulfate gel electrophoresis reveal that the drug primarily accelerates the rate of apoprotein synthesis followed by an increase in the rate of heme synthesis. The messenger for apocytochrome P-450 appears to be fairly stable.

Sequence distribution in Acrylonitrile-methylacrylate random copolymers by N.M.R spectroscopy

The sequence distribution studies on the acrylonitrile-methylmethacrylate copolymer of high methylmethacrylate (M) content (30%sequences is indicated by the pattern of a-methyl protons.

Immunological studies on nucleic-acids and their components .5. Antibodies specific to a deoxyribodinucleotide sequence

Antibodies were raised in rabbits against the bovine serum albumin conjugate of dpApT. Analysis by double diffusion in agar gel and quantitative precipitation test showed the presence of antibodies specific to the hapten in the antisera. Quantitative data on the specificity of the antibodies were obtained by studying the inhibition of the binding of 3H-dpApT to the anti-sera by various nonradioactive mono- and oligonucleotides, using a nitrocellulose membrane binding assay. The antibodies were found to be highly specific for the dinucleotide sequence dpApT. The antibodies were able to bind to synthetic oligonucleotides containing the sequence dpApT and to denatured calf thymus DNA.

Tributyltin chloride-sodium cyanoborohydride mediated tandem radical cyclisation-reductive demethoxylation sequence

Reaction of the bromoketals 3, 7a-g and 11 with tri-n-butyltin chloride and sodium cyanoborohydride in the presence of a catalytic amount of AIBN furnished the ethers 5, 8a-g and 13 via a tandem sequence comprising of a radical cyclisation reaction and tri-n-butylhalostannane and sodium cyanoborohydride mediated reductive demethoxylation of the resulting cyclic ketals.

Nucleotide sequence of the 3' terminal region of belladonna mottle virus-Iowa (renamed Physalis mottle virus) RNA and an analysis of the relationships of tymoviral coat proteins

The 3prime terminal 1255nt sequence of Physalis mottle virus (PhMV) genomic RNA has been determined from a set of overlapping cDNA clones. The open reading frame (ORF) at the 3prime terminus corresponds to the amino acid sequence of the coat protein (CP) determined earlier except for the absence of the dipeptide, Lys-Leu, at position 110-111. In addition, the sequence upstream of the CP gene contains the message coding for 178 amino acid residues of the C-terminus of the putative replicase protein (RP). The sequence downstream of the CP gene contains an untranslated region whose terminal 80 nucleotides can be folded into a characteristic tRNA-like structure. A phylogenetic tree constructed after aligning separately the sequence of the CP, the replicase protein (RP) and the tRNA-like structure determined in this study with the corresponding sequences of other tymoviruses shows that PhMV wrongly named belladonna mottle virus [BDMV(I)] is a separate tymovirus and not another strain of BDMV(E) as originally envisaged. The phylogenetic tree in all the three cases is identical showing that any subset of genomic sequence of sufficient length can be used for establishing evolutionary relationships among tymoviruses.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.

A common epitope of beta-lactoglobulin and serum retinol-binding proteins: Elucidation of its core sequence using synthetic peptides

One of the monoclonal antibodies raised against bovine beta-lactoglobulin reacted with human serum retinol binding protein. The finding that this monoclonal antibody also reacted with the serum retinol binding proteins isolated from other animals, suggested that this epitopic conformation is conserved among these proteins. Using ELISA and various synthetic peptides of defined sequence, we show in this paper that the epitope defined by this monoclonal antibody comprises of the highly conserved core sequence of DTDY present in beta-lactoglobulin and retinol binding proteins.

Comparative sequence analysis and expression in E-coli of the subgroup I-specific antigen VP6 from a G2 serotype human rotavirus IS2

VP6, the intermediate capsid protein of the virion, specifies subgroup specificity of rotavirus, It is also the most conserved, both at nucleotide and amino acid levels, among group A rotaviruses and is the target of choice for rotavirus detection, In this study we report the sequence of the subgroup I (SGI)-specific VP6 from the serotype G2 strain IS2 isolated from a child suffering from acute diarrhoea in Bangalore ana its comparison with the published VP6 sequences. Interestingly, IS2 gene 6 shared highest homology with that from bovine UK strain and the protein contained substitutions by lysine at amino acid positions 97 and 134, In contrast, the amino acids Met and Glu/Asp at these respective positions are highly conserved in all the other group A rotaviruses sequenced so far, These observations have obvious implications for the evolution of serotype G2 and G2-like strains circulating in India, The SGI VP6, of a human rotavirus, possessing epitopes that are conformationally similar to those found in the native protein in the virion, was successfully expressed in E. coli and purified for the first time by single-step affinity chromatography.

Effect of soil variability on the bearing capacity of clay and in slope stability problems

Site-specific geotechnical data are always random and variable in space. In the present study, a procedure for quantifying the variability in geotechnical characterization and design parameters is discussed using the site-specific cone tip resistance data (qc) obtained from static cone penetration test (SCPT). The parameters for the spatial variability modeling of geotechnical parameters i.e. (i) existing trend function in the in situ qc data; (ii) second moment statistics i.e. analysis of mean, variance, and auto-correlation structure of the soil strength and stiffness parameters; and (iii) inputs from the spatial correlation analysis, are utilized in the numerical modeling procedures using the finite difference numerical code FLAC 5.0. The influence of consideration of spatially variable soil parameters on the reliability-based geotechnical deign is studied for the two cases i.e. (a) bearing capacity analysis of a shallow foundation resting on a clayey soil, and (b) analysis of stability and deformation pattern of a cohesive-frictional soil slope. The study highlights the procedure for conducting a site-specific study using field test data such as SCPT in geotechnical analysis and demonstrates that a few additional computations involving soil variability provide a better insight into the role of variability in designs.

Sequence Specific Interaction between Promoter DNA and Escherichia coli RNA Polymerase: Comparative Thermodynamic Analysis with One Immobilized Partner

Sequence specific interaction between DNA and protein molecules has been a subject of active investigation for decades now. Here, we have chosen single promoter containing bacteriophage Delta D-III T7 DNA and Escherichia coli RNA polymerase and followed their recognition at the air-water interface by using the surface plasmon resonance (SPR) technique, where the movement of one of the reacting species is restricted by way of arraying them on an immobilized support. For the Langmuir monolayer studies, we used a RNA polymerase with a histidine tag attached to one of its subunits, thus making it an xcellent substrate for Ni(II) ions, while the SPR Studies were done using biotin-labeled DNA immobilized on a streptavidin-coated chip. Detailed analysis of the thermodynamic parameters as a function of concentration and temperature revealed that the interaction of RNA polymerase with T7 DNA is largely entropy driven (83 (+/- 12) kcal mol(-1)) with a positive enthalpy of 13.6 (+/- 3.6) kcal mol(-1), The free energy of reaction determined by SPR and Langmuir-Blodgett technique was -11 (+/- 2) and -15.6 kcal mol(-1), respectively. The ability of these methods to retain the specificity of the recognition process was also established.

Negative sequence compensation within fundamental positive sequence reference frame for a stiff micro-grid generation in a wind power system using slip ring induction machine

An isolated wind power generation scheme using slip ring induction machine (SRIM) is proposed. The proposed scheme maintains constant load voltage and frequency irrespective of the wind speed or load variation. The power circuit consists of two back-to-back connected inverters with a common dc link, where one inverter is directly connected to the rotor side of SRIM and the other inverter is connected to the stator side of the SRIM through LC filter. Developing a negative sequence compensation method to ensure that, even under the presence of unbalanced load, the generator experiences almost balanced three-phase current and most of the unbalanced current is directed through the stator side converter is the focus here. The SRIM controller varies the speed of the generator with variation in the wind speed to extract maximum power. The difference of the generated power and the load power is either stored in or extracted from a battery bank, which is interfaced to the common dc link through a multiphase bidirectional fly-back dc-dc converter. The SRIM control scheme, maximum power point extraction algorithm and the fly-back converter topology are incorporated from available literature. The proposed scheme is both simulated and experimentally verified.

An algorithm to find similar internal sequence repeats

In recent years, identification of sequence patterns has been given immense importance to understand better their significance with respect to genomic organization and evolutionary processes. To this end, an algorithm has been derived to identify all similar sequence repeats present in a protein sequence. The proposed algorithm is useful to correlate the three-dimensional structure of various similar sequence repeats available in the Protein Data Bank against the same sequence repeats present in other databases like SWISS-PROT, PIR and Genome databases.