Nucleotide sequence of a cucumber chloroplast proline tRNA
| Data(s) |
1997
|
|---|---|
| Resumo |
The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro. |
| Formato |
application/pdf |
| Identificador |
http://eprints.iisc.ernet.in/24657/1/5.pdf Hande, Shailaja and Jayabaskaran, Chelliah (1997) Nucleotide sequence of a cucumber chloroplast proline tRNA. In: Journal of Bioscience, 22 (2). pp. 143-147. |
| Publicador |
Indian academy of sciences |
| Relação |
http://www.ias.ac.in/j_archive/jbiosci/22/2/march(2)97.htm http://eprints.iisc.ernet.in/24657/ |
| Palavras-Chave | #Biochemistry |
| Tipo |
Journal Article PeerReviewed |
