1000 resultados para specific resistivity


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Geoelectrical soundings were carried out in 29 different places in order to find permafrost and to measure its thickness. In most places above timber Iine a permafrost thickness of 10-50 m was recorded. Permafrost was found at sites with thin snow cover during winter. Here, deflation phenomena on the summits of fjells indicate the occurence of permafrost, Vegetation type might be a good indicator of permafrost, too. It seems obvious that permafrost exists extensively on fjell summits of northern Finland.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The present study assessed the relative contribution of each body segment to whole body fat-free mass (FFM) and impedance and explored the use of segmental bioelectrical impedance analysis to estimate segmental tissue composition. Multiple frequencies of whole body and segmental impedances were measured in 51 normal and overweight women. Segmental tissue composition was independently assessed by dual-energy X-ray absorptiometry. The sum of the segmental impedance values corresponded to the whole body value (100.5 +/- 1.9% at 50 kHz). The arms and legs contributed to 47.6 and 43.0%, respectively, of whole body impedance at 50 kHz, whereas they represented only 10.6 and 34.8% of total FFM, as determined by dual-energy X-ray absorptiometry. The trunk averaged 10.0% of total impedance but represented 48.2% of FFM. For each segment, there was an excellent correlation between the specific impedance index (length2/impedance) and FFM (r = 0.55, 0.62, and 0.64 for arm, trunk, and leg, respectively). The specific resistivity was in a similar range for the limbs (159 +/- 23 cm for the arm and 193 +/- 39 cm for the leg at 50 kHz) but was higher for the trunk (457 +/- 71 cm). This study shows the potential interest of segmental body composition by bioelectrical impedance analysis and provides specific segmental body composition equations for use in normal and overweight women.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The University of British Columbia (UBC) began performing piezocone penetration tests (CPTU) with electrical resistivity measurements (RCPTU) in 1989. Since then, RCPTU research at UBC has focused on obtaining geo-environmental parameters such as fluid resistivity and soil engineering properties such as porosity and degree of saturation from measurements of bulk soil electrical resistivity using the empirical relationship proposed by Archie (1942). Within this framework, the paper illustrates and discusses important design and calibration issues for resistivity modules such as the use of isolated circuitry to achieve linear calibrations over large ranges of resistivity. The suitability of RCPTU measurements for determination of geo-environmental and geotechnical parameters are assessed using typical ranges of soil and groundwater properties and methods of isolating individual factors for study are discussed. Illustrative examples of RCPTU research efforts including the environmental characterization of mine tailings, delineation of saline water intrusions in fresh water aquifers and the quality control of geotechnical ground densification are presented throughout the text. It is shown that groundwater temperature and hence ion mobility is not significantly altered by frictional heat generated during piezocone penetration and that ratio-based approaches to monitoring soil porosity can be used to eliminate the requirement for extensive groundwater sampling programs. Lastly, it is shown that RCPTU measurements above the water table can only be made using resistivity modules that are stable over a large range of resistivities and that such measurements are the most difficult to interpret because of grain surface conduction effects and generally unknown fluid resistivities.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The specific heat of single-crystal U Pd2 Si2 has been studied using both the step heating and continious heating methods for the temperature range 2 to 250 K. Successive phase transitions at Tl = 136I< and T2 = 108I< are reported, which are consistent with current publications. The transition at 40K, which was previously reported, has not been detected. Recent published elastic neutron scattering data, magnetic susceptibility and resistivity results suggest that U Pd2 Si2 may be a heavy fermion compound, however, the electronic specific heat coefficient I (= 18.97 ;~), obtained from the specific heat Cv measurements, is smaller than that of the conventional heavy fermion system. The Debye temperature of U Pd2Si2 is found to be 116.55K. The possibility is discussed that the maximum in CIT in the low-temperature range 2 to 4K corresponds to Schottky anomaly induced by localized magnetic impurities .

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Electrical methods of geophysical survey are known to produce results that are hard to predict at different times of the year, and under differing weather conditions. This is a problem which can lead to misinterpretation of archaeological features under investigation. The dynamic relationship between a ‘natural’ soil matrix and an archaeological feature is a complex one, which greatly affects the success of the feature’s detection when using active electrical methods of geophysical survey. This study has monitored the gradual variation of measured resistivity over a selection of study areas. By targeting difficult to find, and often ‘missing’ electrical anomalies of known archaeological features, this study has increased the understanding of both the detection and interpretation capabilities of such geophysical surveys. A 16 month time-lapse study over 4 archaeological features has taken place to investigate the aforementioned detection problem across different soils and environments. In addition to the commonly used Twin-Probe earth resistance survey, electrical resistivity imaging (ERI) and quadrature electro-magnetic induction (EMI) were also utilised to explore the problem. Statistical analyses have provided a novel interpretation, which has yielded new insights into how the detection of archaeological features is influenced by the relationship between the target feature and the surrounding ‘natural’ soils. The study has highlighted both the complexity and previous misconceptions around the predictability of the electrical methods. The analysis has confirmed that each site provides an individual and nuanced situation, the variation clearly relating to the composition of the soils (particularly pore size) and the local weather history. The wide range of reasons behind survey success at each specific study site has been revealed. The outcomes have shown that a simplistic model of seasonality is not universally applicable to the electrical detection of archaeological features. This has led to the development of a method for quantifying survey success, enabling a deeper understanding of the unique way in which each site is affected by the interaction of local environmental and geological conditions.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

A suit able decision-making on managing a contaminated site characterization program is strongly dependent of the diagnosis process. A detailed diagnosis can be done based on a Conceptual Site Model (CSM) elaboration using high resolution site characterization tools. The piezocone (CPTu) test is a high resolution tool which allows attaching several specific sensors, like the resistivity probe. This hybrid device is called the resistivity piezocone (RCPTu). A simulated geo-environmental site characterization program was performed on an erosion site using different tools (direct push tools soil samplers, hollow stem auger (HSA) drilling and RCPTu tests) to develop the CSM for a site similar to the Brazilian conditions. It was observed a good agreement between the site profiles interpreted by the different methods. The resistivity sensor attached to the piezocone improved the interpretation and the decision-making process on site was significantly better for the CSM elaboration. The RCPTu test data also allowed identifying the hydrogeological heterogeneities. The present study shows that the RCPTu test is also a useful and powerful tool to development an accurate CSM in a Brazilian condition, especially in an approach that prioritizes high resolution geo-environmental investigation. © 2013 Taylor & Francis Group.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

With a view toward investigating the feeding behavior of Culicidae mosquitoes from an area of epizootic yellow fever transmission in the municipalities of Garruchos and Santo Antônio das Missões, Rio Grande do Sul State, Brazil, specimens were collected by aspiration from September 2005 to April 2007. The engorged females were submitted to blood meal identification by enzyme-linked immunosorbent assay (ELISA). A total of 142 blood-engorged samples were examined for human or monkey blood through species-specific IgG. Additional tests for specificity utilizing isotypes IgG1 and IgG4 of human monoclonal antibodies showed that only anti-human IgG1 was effective in recognizing blood meals of human origin. The results indicated a significant difference (p = 0.027) in detection patterns in samples of Haemagogus leucocelaenus recorded from human blood meals at Santo Antônio das Missões, which suggests some degree of exposure, since it was an area where epizootic outbreaks have been reported.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

While a queen control pheromone complex that inhibits worker ovary development has been described for honey bees, no comparable control pheromones have been identified for their sister group, the stingless bees. The aim of the present work was to search for possible control pheromones in the stingless bee Friesella schrottkyi. No volatile substances were found in the heads of queens that might serve as queen control pheromones. On the other hand, distinct differences were found between the cuticular substances of queens and workers. The major hydrocarbons were different between the two castes, and while queens contained methyl-branched alkanes and no unsaturated hydrocarbons, workers contained alkenes and alka-dienes but no methyl branched hydrocarbons. Colonies deprived of a queen produced laying workers. Differences were observed in the cuticular patterns of laying workers and workers from a queen controlled colony.