960 resultados para seral stages


Relevância:

70.00% 70.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Sediment cores are an essential tool for the analysis of the dynamics of mangrove succession. Coring was used to correlate changes in depositional environments and lateral sedimentary facies with discrete stages of forest succession at the Cananéia-Iguape Coastal System in southeastern Brazil. A local level successional pattern was examined based on four core series T1) a sediment bank; T2) a smooth cordgrass Spartina alterniflora bank; T3) an active mangrove progradation fringe dominated by Laguncularia racemosa, and; T4) a mature mangrove forest dominated by Avicennia schaueriana. Cores were macroscopically described in terms of color, texture, sedimentary structure and organic components. The base of all cores exhibited a similar pattern suggesting common vertical progressive changes in depositional conditions and subsequent successional colonization pattern throughout the forest. The progradation zone is an exposed bank, colonized by S. alterniflora. L. racemosa, replaces S. alterniflora as progradation takes place. As the substrate consolidates A. schaueriana replaces L. racemosa and attains the greatest structural development in the mature forest. Cores collected within the A. schaueriana dominated stand contained S. alterniflora fragments near the base, confirming that a smooth cordgrass habitat characterized the establishment and early seral stages. Cores provide a reliable approach to describe local-level successional sequences in dynamic settings subject to drivers operating on multiple temporal and spatial scales where spatial heterogeneity can lead to multiple equilibria and where similar successional end-points may be reached through convergent paths.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The aim of this thesis was to evaluate historical change of the landscape of Madeira Island and to assess spatial and temporal vegetation dynamics. In current research diverse “retrospective techniques”, such as landscape repeat photography, dendrochronology, and research of historical records were used. These, combined with vegetation relevés, aimed to gather information about landscape change, disturbance history, and vegetation successional patterns. It was found that landscape change, throughout 125 years, was higher in the last five decades manly driven by farming abandonment, building growth and exotic vegetation coverage increase. Pristine vegetation was greatly destroyed since early settlement and by the end of the nineteenth century native vegetation was highly devastated due to recurrent antropogenic disturbances. These actions also helped to block plant succession and to modify floristical assemblages, affecting as well as species richness. In places with less hemeroby, although significant growth of vegetation of lower seral stages was detected, the vegetation of most mature stages headed towards unbalance between recovery and loss, being also very vulnerable to exotic species encroachment. Recovery by native vegetation also occurred in areas formerly occupied by exotic plants and agriculture but it was almost negligible. Vegetation recovery followed the successional model currently proposed, attesting the model itself. Yet, succession was slower than espected, due to lack of favourable conditions and to recurrent disturbances. Probable tempus of each seral stage was obtained by growth rates of woody taxa estimated through dendrochronology. The exotic trees which were the dominant trees in the past (Castanea sativa and Pinus pinaster) almost vanished. Eucalyptus globulus, the current main tree of the exotic forest is being replaced by other cover types as Acacia mearnsii. The latter, along with Arundo donax, Cytisus scoparius and Pittosporum undulatum are currently the exotic species with higher invasive behaviour. However, many other exotic species have also proved to be highly pervasive and came together with the ones referred above to prevent native vegetation regeneration, to diminish biological diversity, and to block early successional phases delaying native forest recovery.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

We studied the succession of small mammal species after fire in the cerrado (Neotropical savanna) of Central Brazil. Populations of small mammals were sampled with live-trapping techniques in a series of nine sites of different successional age, ranging from 1 to 26 years after fire. Ten species of small mammals were captured through all the seral stages of succession. Species richness ranged from two to seven species by seral stage. The species were arranged in different groups with respect to abundance along the succession: the first was composed of early successional species that peaked <2 years after fire (Calomys callosus, C. tener, Thalpomys cerradensis, Mus musculus, Thylamys velutinus); the second occurred or peaked 2-3 years after fire (Necromys lasiurus, Gracilinanus sp., Oryzomys scoth). Gracilinanus agilis peaked in the last seral stage. Species richness of small mammals showed an abrupt decrease from an average of four species immediately after fire to two species 5-26 years after the last fire. We propose a simple graphical model to explain the pattern of species richness of small mammals after fire in the cerrado. This model assumes that the occurrence of species of small mammals is determined by habitat selection behavior by each species along a habitat gradient. The habitat gradient is defined as the ratio of cover of herbaceous to woody vegetation. The replacement of species results from a trade-off in habitat requirements for the two habitat variables.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

In the Cerrado savannas from Brazil fire events are common and strongly influence the vegetation structure and, consequently, the associated small mammals. In this paper, we investigate changes in the structure of small mammal communities related to sites of different post-fire ages. Mammals were captured in similar Cerrado sites that differed in time since the last burn ( 1 to 26 yr). We sampled six sites in the wet season of 1997 ( phase 1) and, three years later, six sites in the wet and dry seasons ( phase 2). Six rodent species and four marsupials were captured. Community composition changed drastically as a function of time since fire. The diversity and abundance of small mammals reached maximum values in the early successional stages. The rodent Calomys tener was present only in early seral stages. The rodent Bolomys lasiurus was more frequent in mid-successional stages and decreased in later seral stages, and the rodent Oryzomys subflavus occupied all successional stages. The marsupial Gracilinanus agilis was dominant in the area that did not burn for at least 23 yr. Changes in composition of the community of small mammals were more accelerated in early successional stages, when there are more drastic vegetational changes. The ability of small mammals to cope with Cerrado fires and the great dissimilarity among post-burning seral stages suggest that a mosaic of areas representing different post-fire seral stages could increase the regional diversity of this group.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Sediment cores are an essential tool for the analysis of the dynamics of mangrove succession. Coring was used to correlate changes in depositional environments and lateral sedimentary facies with discrete stages of forest succession at the Cananeia-Iguape Coastal System in southeastern Brazil. A local level successional pattern was examined based on four core series T1) a sediment bank; T2) a smooth cordgrass Spartina alterniflora bank; T3) an active mangrove progradation fringe dominated by Laguncularia racemosa, and; T4) a mature mangrove forest dominated by Avicennia schaueriana. Cores were macroscopically described in terms of color, texture, sedimentary structure and organic components. The base of all cores exhibited a similar pattern suggesting common vertical progressive changes in depositional conditions and subsequent successional colonization pattern throughout the forest. The progradation zone is an exposed bank, colonized by S. alterniflora. L. racemosa, replaces S. alterniflora as progradation takes place. As the substrate consolidates A. schaueriana replaces L. racemosa and attains the greatest structural development in the mature forest. Cores collected within the A. schaueriana dominated stand contained S. alterniflora fragments near the base, confirming that a smooth cordgrass habitat characterized the establishment and early seral stages. Cores provide a reliable approach to describe local-level successional sequences in dynamic settings subject to drivers operating on multiple temporal and spatial scales where spatial heterogeneity can lead to multiple equilibria and where similar successional end-points may be reached through convergent paths.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The aim of this thesis was to evaluate historical change of the landscape of Madeira Island and to assess spatial and temporal vegetation dynamics. In current research diverse “retrospective techniques”, such as landscape repeat photography, dendrochronology, and research of historical records were used. These, combined with vegetation relevés, aimed to gather information about landscape change, disturbance history, and vegetation successional patterns. It was found that landscape change, throughout 125 years, was higher in the last five decades manly driven by farming abandonment, building growth and exotic vegetation coverage increase. Pristine vegetation was greatly destroyed since early settlement and by the end of the nineteenth century native vegetation was highly devastated due to recurrent antropogenic disturbances. These actions also helped to block plant succession and to modify floristical assemblages, affecting as well as species richness. In places with less hemeroby, although significant growth of vegetation of lower seral stages was detected, the vegetation of most mature stages headed towards unbalance between recovery and loss, being also very vulnerable to exotic species encroachment. Recovery by native vegetation also occurred in areas formerly occupied by exotic plants and agriculture but it was almost negligible. Vegetation recovery followed the successional model currently proposed, attesting the model itself. Yet, succession was slower than espected, due to lack of favourable conditions and to recurrent disturbances. Probable tempus of each seral stage was obtained by growth rates of woody taxa estimated through dendrochronology. The exotic trees which were the dominant trees in the past (Castanea sativa and Pinus pinaster) almost vanished. Eucalyptus globulus, the current main tree of the exotic forest is being replaced by other cover types as Acacia mearnsii. The latter, along with Arundo donax, Cytisus scoparius and Pittosporum undulatum are currently the exotic species with higher invasive behaviour. However, many other exotic species have also proved to be highly pervasive and came together with the ones referred above to prevent native vegetation regeneration, to diminish biological diversity, and to block early successional phases delaying native forest recovery.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The development of new drugs is one strategy for malaria control. Biochemical pathways localised in the apicoplast of the parasite, such as the synthesis of isoprenic precursors, are excellent targets because they are different or absent in the human host. Isoprenoids are a large and highly diverse group of natural products with many functions and their synthesis is essential for the parasite's survival. During the last few years, the genes, enzymes, intermediates and mechanisms of this biosynthetic route have been elucidated. In this review, we comment on some aspects of the methylerythritol phosphate pathway and discuss the presence of diverse isoprenic products such as dolichol, ubiquinone, carotenoids, menaquinone and isoprenylated proteins, which are biosynthesised during the intraerythrocytic stages of Plasmodium falciparum.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Stages of change assess individual motivation for lifestyle changes, contributing to the development of more effective intervention strategies. The objective of the present study was to identify factors associated with stages of change for lower intake of red meat and higher intake of vegetables in a cross-sectional analysis of 578 Japanese-Brazilians aged 30-90 years. In adjusted logistic regression models, the odds ratios for women (OR = 1.89; 95%CI: 1.154; 3.103) and physically active individuals (OR = 1.00; 95%CI: 1.000; 1.001) were positively associated with stage of "action" for the higher intake of vegetables. Inverse associations were observed between central obesity (OR = 0.5; 95%CI: 0.351; 0.887) and highest tertile of red meat intake (OR = 0.50; 95%CI: 0.302; 0.817), as well as a positive association between age (OR = 1.04; 95%CI: 1.020; 1.070) and the stage of "action" to the lower intake of meat were verified. Motivation for Japanese-Brazilians to change their food intake was linked to lifestyle. Stage of change is an important factor in mediating food intake behavior change.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present K-band spectra of the near infrared counterparts to IRS 2E and IRS 2W which is associated with the ultracompact H II region W51d, both of them embedded sources in the Galactic compact H II region W51 IRS 2. The high spatial resolution observations were obtained with the laser guide star facility and Near-infrared Integral Field Spectrograph (NIFS) mounted at the Gemini-North observatory. The spectrum of the ionizing source of W51d shows the photospheric features N III ( 21155 angstrom) in emission and He II ( 21897 angstrom) in absorption which lead us to classify it as a young O3 type star. We detected CO overtone in emission at 23000 angstrom in the spectrum of IRS 2E, suggesting that it is a massive young object still surrounded by an accretion disk, probably transitioning from the hot core phase to an ultracompact H II region.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context. Compact groups of galaxies are entities that have high densities of galaxies and serve as laboratories to study galaxy interactions, intergalactic star formation and galaxy evolution. Aims. The main goal of this study is to search for young objects in the intragroup medium of seven compact groups of galaxies: HCG 2, 7, 22, 23, 92, 100 and NGC 92 as well as to evaluate the stage of interaction of each group. Methods. We used Fabry-Perot velocity fields and rotation curves together with GALEX NUV and FUV images and optical R-band and HI maps. Results. (i) HCG 7 and HCG 23 are in early stages of interaction; (ii) HCG 2 and HCG 22 are mildly interacting; and (iii) HCG 92, HCG 100 and NGC 92 are in late stages of evolution. We find that all three evolved groups contain populations of young blue objects in the intragroup medium, consistent with ages < 100 Myr, of which several are younger than < 10 Myr. We also report the discovery of a tidal dwarf galaxy candidate in the tail of NGC 92. These three groups, besides containing galaxies that have peculiar velocity fields, also show extended HI tails. Conclusions. Our results indicate that the advanced stage of evolution of a group, together with the presence of intragroup HI clouds, may lead to star formation in the intragroup medium. A table containing all intergalactic HII regions and tidal dwarf galaxies confirmed to date is appended.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study describes the effects of different intensities of UVB radiation on growth and morphology of early development stages of Iridaea cordata in germlings, young gametophytes originated in the laboratory and young fronds collected in the Magellan Strait, Chile. The experiments were carried out during four weeks in controlled conditions of temperature and photoperiod and the results were compared with a control treatment (without UVB). All UVB irradiation treatments caused bleaching and decrease in growth rates of germlings. Additionally, initial upright fronds were not observed in any of the UVB treatments, where as those cultivated in UVB absence developed erect ones in the second week of culture. The young gametophytes exhibited morphological alteration (small number and size of basal ramifications, curling of tips, bleaching and necrosis) and decrease in growth when exposed to UVB radiation. Young fronds collected from the field showed mainly morphological alterations (curling of frond). Morphological alterations in young gametophytes and young fronds of I. cordata could be interpreted as a defense against UVB by reducing the area exposed to radiation. However, high level of UVB radiation can produce irreparable damage, such as necrosis, observed in young gametophytes originated in the laboratory. Finally, the UVB effects on early developmental stages of I. cordata depend on the UVB irradiance and time of exposition.