On-the-Fly Maintenance of Series-Parallel Relationships in Fork-Join Multithreaded Programs

A key capability of data-race detectors is to determine whether one thread executes logically in parallel with another or whether the threads must operate in series. This paper provides two algorithms, one serial and one parallel, to maintain series-parallel (SP) relationships "on the fly" for fork-join multithreaded programs. The serial SP-order algorithm runs in O(1) amortized time per operation. In contrast, the previously best algorithm requires a time per operation that is proportional to Tarjan’s functional inverse of Ackermann’s function. SP-order employs an order-maintenance data structure that allows us to implement a more efficient "English-Hebrew" labeling scheme than was used in earlier race detectors, which immediately yields an improved determinacy-race detector. In particular, any fork-join program running in T₁ time on a single processor can be checked on the fly for determinacy races in O(T₁) time. Corresponding improved bounds can also be obtained for more sophisticated data-race detectors, for example, those that use locks. By combining SP-order with Feng and Leiserson’s serial SP-bags algorithm, we obtain a parallel SP-maintenance algorithm, called SP-hybrid. Suppose that a fork-join program has n threads, T₁ work, and a critical-path length of T[subscript ∞]. When executed on P processors, we prove that SP-hybrid runs in O((T₁/P + PT[subscript ∞]) lg n) expected time. To understand this bound, consider that the original program obtains linear speed-up over a 1-processor execution when P = O(T₁/T[subscript ∞]). In contrast, SP-hybrid obtains linear speed-up when P = O(√T₁/T[subscript ∞]), but the work is increased by a factor of O(lg n).

Vibration analysis for Bearing outer race condition diagnostics

This paper investigates defect detection methodologies for rolling element bearings through vibration analysis. Specifically, the utility of a new signal processing scheme combining the High Frequency Resonance Technique (HFRT) and Adaptive Line Enhancer (ALE) is investigated. The accelerometer is used to acquire data for this analysis, and experimental results have been obtained for outer race defects. Results show the potential effectiveness of the signal processing technique to determine both the severity and location of a defect. The HFRT utilizes the fact that much of the energy resulting from a defect impact manifests itself in the higher resonant frequencies of a system. Demodulation of these frequency bands through use of the envelope technique is then employed to gain further insight into the nature of the defect while further increasing the signal to noise ratio. If periodic, the defect frequency is then present in the spectra of the enveloped signal. The ALE is used to enhance the envelope spectrum by reducing the broadband noise. It provides an enhanced envelope spectrum with clear peaks at the harmonics of a characteristic defect frequency. It is implemented by using a delayed version of the signal and the signal itself to decorrelate the wideband noise. This noise is then rejected by the adaptive filter that is based upon the periodic information in the signal. Results have been obtained for outer race defects. They show the effectiveness of the methodology to determine both the severity and location of a defect. In two instances, a linear relationship between signal characteristics and defect size is indicated.

Metabolic syndrome and cardiovascular mortality among participants of the hypertension detection and follow-up program

Metabolic Syndrome (MetS) is a clustering of cardiovascular (CV) risk factors that includes obesity, dyslipidemia, hyperglycemia, and elevated blood pressure. Applying the criteria for MetS can serve as a clinically feasible tool for identifying patients at high risk for CV morbidity and mortality, particularly those who do not fall into traditional risk categories. The objective of this study was to examine the association between MetS and CV mortality among 10,940 American hypertensive adults, ages 30-69 years, participating in a large randomized controlled trial of hypertension treatment (HDFP 1973-1983). MetS was defined as the presence of hypertension and at least two of the following risk factors: obesity, dyslipidemia, or hyperglycemia. Of the 10,763 individuals with sufficient data available for analysis, 33.2% met criteria for MetS at baseline. The baseline prevalence of MetS was significantly higher among women (46%) than men (22%) and among non-blacks (37%) versus blacks (30%). All-cause and CV mortality was assessed for 10,763 individuals. Over a median follow-up of 7.8 years, 1,425 deaths were observed. Approximately 53% of these deaths were attributed to CV causes. Compared to individuals without MetS at baseline, those with MetS had higher rates of all-cause mortality (14.5% v. 12.6%) and CV mortality (8.2% versus 6.4%). The unadjusted risk of CV mortality among those with MetS was 1.31 (95% confidence interval [CI], 1.12-1.52) times that for those without MetS at baseline. After multiple adjustment for traditional risk factors of age, race, gender, history of cardiovascular disease (CVD), and smoking status, individuals with MetS, compared to those without MetS, were 1.42 (95% CI, 1.20-1.67) times more likely to die of CV causes. Of the individual components of MetS, hyperglycemia/diabetes conferred the strongest risk of CV mortality (OR 1.73; 95% CI, 1.39-2.15). Results of the present study suggest MetS defined as the presence of hypertension and 2 additional cardiometabolic risk factors (obesity, dyslipidemia, or hyperglycemia/diabetes) can be used with some success to predict CV mortality in middle-aged hypertensive adults. Ongoing and future prospective studies are vital to examine the association between MetS and cardiovascular morbidity and mortality in select high-risk subpopulations, and to continue evaluating the public health impact of aggressive, targeted screening, prevention, and treatment efforts to prevent future cardiovascular disability and death.^

THE RELATIONSHIP BETWEEN SERUM CHOLESTEROL AND CANCER INCIDENCE IN THE POPULATION OF THE HYPERTENSION DETECTION AND FOLLOW-UP PROGRAM

The relationship between serum cholesterol and cancer incidence was investigated in the population of the Hypertension Detection and Follow-up Program (HDFP). The HDFP was a multi-center trial designed to test the effectiveness of a stepped program of medication in reducing mortality associated with hypertension. Over 10,000 participants, ages 30-69, were followed with clinic and home visits for a minimum of five years. Cancer incidence was ascertained from existing study documents, which included hospitalization records, autopsy reports and death certificates. During the five years of follow-up, 286 new cancer cases were documented. The distribution of sites and total number of cases were similar to those predicted using rates from the Third National Cancer Survey. A non-fasting baseline serum cholesterol level was available for most participants. Age, sex, and race specific five-year cancer incidence rates were computed for each cholesterol quartile. Rates were also computed by smoking status, education status, and percent ideal weight quartiles. In addition, these and other factors were investigated with the use of the multiple logistic model.^ For all cancers combined, a significant inverse relationship existed between baseline serum cholesterol levels and cancer incidence. Previously documented associations between smoking, education and cancer were also demonstrated but did not account for the relationship between serum cholesterol and cancer. The relationship was more evident in males than females but this was felt to represent the different distribution of occurrence of specific cancer sites in the two sexes. The inverse relationship existed for all specific sites investigated (except breast) although a level of statistical significance was reached only for prostate carcinoma. Analyses after exclusion of cases diagnosed during the first two years of follow-up still yielded an inverse relationship. Life table analysis indicated that competing risks during the period of follow-up did not account for the existence of an inverse relationship. It is concluded that a weak inverse relationship does exist between serum cholesterol for many but not all cancer sites. This relationship is not due to confounding by other known cancer risk factors, competing risks or persons entering the study with undiagnosed cancer. Not enough information is available at the present time to determine whether this relationship is causal and further research is suggested. ^

Fasting blood glucose and 8-year mortality in the hypertension detection follow-up program population

This study analyzed the relationship between fasting blood glucose (FBG) and 8-year mortality in the Hypertension Detection Follow-up Program (HDFP) population. Fasting blood glucose (FBG) was examined both as a continuous variable and by specified FBG strata: Normal (FBG 60–100 mg/dL), Impaired (FBG ≥100 and ≤125 mg/dL), and Diabetic (FBG>125 mg/dL or pre-existing diabetes) subgroups. The relationship between type 2 diabetes was examined with all-cause mortality. This thesis described and compared the characteristics of fasting blood glucose strata by recognized glucose cut-points; described the mortality rates in the various fasting blood glucose strata using Kaplan-Meier mortality curves, and compared the mortality risk of various strata using Cox Regression analysis. Overall, mortality was significantly greater among Referred Care (RC) participants compared to Stepped Care (SC) {HR = 1.17; 95% CI (1.052,1.309); p-value = 0.004}, as reported by the HDFP investigators in 1979. Compared with SC participants, the RC mortality rate was significantly higher for the Normal FBG group {HR = 1.18; 95% CI (1.029,1.363); p-value = 0.019} and the Impaired FBG group, {HR = 1.34; 95% CI (1.036,1.734); p-value = 0.026,}. However, for the diabetic group, 8-year mortality did not differ significantly between the RC and SC groups after adjusting for race, gender, age, smoking status among Diabetic individuals {HR = 1.03; 95% CI (0.816,1.303); p-value = 0.798}. This latter finding is possibly due to a lack of a treatment difference of hypertension among Diabetic participants in both RC and SC groups. The largest difference in mortality between RC and SC was in the Impaired subgroup, suggesting that hypertensive patients with FBG between 100 and 125 mg/dL would benefit from aggressive antihypertensive therapy.^

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.