959 resultados para physiologic stages
Resumo:
This research presents a comparative study of enzymatic activity of the hypopharyngeal gland extracts from workers of Apis mellifera in three physiologic stages: newly emerged, nurse and forager workers, with the objective of contributing to the comprehension of the gland function. In order to determinate the enzymes present in the extracts, the Api Zym kit (Bio Merieux) was used to test the activity of 19 different enzymes. The enzymes found in larger amounts only in the hypopharyngeal glands from certain individuals were the following: in newly emerged workers, the N-acetyl-double down arrow-glucosaminidase that may be digesting the chitin of some food ingested by the bee; in forager workers, the acid phosphatase that is likely acting in authophagic processes, the a-glucosidase, in the processing of nectar into honey, and the double down arrow-glucosidases, in the pollen digestion.
Resumo:
A utilização de funções matemáticas para descrever o crescimento animal é antiga. Elas permitem resumir informações em alguns pontos estratégicos do desenvolvimento ponderal e descrever a evolução do peso em função da idade do animal. Também é possível comparar taxas de crescimento de diferentes indivíduos em estados fisiológicos equivalentes. Os modelos de curvas de crescimento mais utilizados na avicultura são os derivados da função Richards, pois apresentam parâmetros que possibilitam interpretação biológica e portanto podem fornecer subsídios para seleção de uma determinada forma da curva de crescimento em aves. Também pode-se utilizar polinômios segmentados para descrever as mudanças de tendência da curva de crescimento animal. Entretanto, existem importantes fatores de variação para os parâmetros das curvas, como a espécie, o sistema de criação, o sexo e suas interações. A adequação dos modelos pode ser verificada pelos valores do coeficiente de determinação (R2), do quadrado médio do resíduo (QM res), do erro de predição médio (EPm), da facilidade de convergência dos dados e pela possibilidade de interpretação biológica dos parâmetros. Estudos envolvendo modelagem e descrição da curva de crescimento e seus componentes são amplamente discutidos na literatura. Porém, programas de seleção que visem a progressos genéticos para a forma da curva não são mencionados. A importância da avaliação dos parâmetros dos modelos de curvas de crescimento é ainda mais relevante já que os maiores ganhos genéticos para peso estão relacionados com seleção para pesos em idades próximas ao ponto de inflexão. A seleção para precocidade pode ser auxiliada com base nos parâmetros do modelo associados à variáveis que descrevem esta característica genética dos animais. Esses parâmetros estão relacionados a importantes características produtivas e reprodutivas e apresentam magnitudes diferentes, de acordo com a espécie, o sexo e o modelo utilizados na avaliação. Outra metodologia utilizada são os modelos de regressão aleatória, permitindo mudanças graduais nas covariâncias entre idades ao longo do tempo e predizendo variâncias e covariâncias em pontos contidos ao longo da trajetória estudada. A utilização de modelos de regressões aleatórias traz como vantagem a separação da variação da curva de crescimento fenotípica em seus diferentes efeitos genético aditivo e de ambiente permanente individual, mediante a determinação dos coeficientes de regressão aleatórios para esses diferentes efeitos. Além disto, não há necessidade de utilizar fatores de ajuste para a idade. Esta revisão teve por objetivos levantar os principais modelos matemáticos frequentistas utilizados no estudo de curvas de crescimento de aves, com maior ênfase nos empregados com a finalidade de estimar parâmetros genéticos e fenotípicos.
Resumo:
The search for new alternatives in order to increase soybeans productivity has been constant objective of researchers and farmers. The crop responses to phosphorus application in the soil are well defined, being this nutrient very important on its development and yield. The leaf fertilization on this crop appears as a new rationale option, mainly when the plant nutrient levels are low. So, this work aimed to study the effect of phosphorus leaf fertilization, applied at different plant stage, including: V5, R1, R4, V5 + R1, V5 + R4, R1 + R4, V5 + R1 + R4, V5 + R1 + R4 + R6 and test plot. The experiment was installed in a soybeans crop, Monarca cultivar, at Palmital Farm, Ijaci county, Minas Gerais state, Brazil, using a totally randomized design, with 9 treatments and 3 replications. The chelate Quimifol P30 in liquid form with 30% of the nutrient soluble in CNA + water in the, with doses of 21. ha(-1), was utilized as phosphorus source, using the applications performed with a constant pressure CO(2)-nebulizer. The different epochs of phosphorous application significantly altered the grains yield, proportioning significant increases, up to 16% for the V5, V5 + R1, V5 + R4, V5 + R1 + R4, V5 + R1 + R4 + R6 epochs, when compared to the test plot, clearly expressing the positive effect of these applications at V5 stage. The plant height, first legume insertion, and lodging index characteristics were not significantly altered by the different epochs evaluated. It was observed significant response for the nutrient leaf amounts only in the case of K and Zn indices, exclusively in the V5 + R4, and in the V5, V5 + R1 and V5 + R1 + R4 + R6 treatments, respectively.
Resumo:
This research presents a comparative study of enzymatic activity of the hypopharyngeal gland extracts from workers of Apis mellifera in three physiologic stages: newly emerged, nurse and forager workers, with the objective of contributing to the comprehension of the gland function. In order to determinate the enzymes present in the extracts, the Api Zym kit (Bio Mérieux) was used to test the activity of 19 different enzymes. The enzymes found in larger amounts only in the hypopharyngeal glands from certain individuals were the following: in newly emerged workers, the N-acetyl-down double arrow sign-glucosaminidase that may be digesting the chitin of some food ingested by the bee; in forager workers, the acid phosphatase that is likely acting in authophagic processes, the a-glucosidase, in the processing of nectar into honey, and the down double arrow sign-glucosidases, in the pollen digestion.
Resumo:
The work: was carried out to evaluate the physiologic and productive responses of 16 Holstein breed cows, in different lactating stages and production levels, maintained in two free stall corral types, with or without plastic sheet covering, in the southeast-northwest of the covered area edges. The animals were confined in free stall system, during the months of the summer, with access to the constant or Limited shade. A complete randomized experimental design was: used. The physiological variables measured were respiratory frequency (morning an afternoon) and rectal temperature (morning and afternoon). The productive variables were milk production (morning, afternoon and daily), dry matter (DM) intake (% live weight) and efficiency of milk production (kg of milk/kg DM intake). The animals with access to the constant shade presented respiratory frequency (74.1 vs 81.0 breath/min.) and rectal temperature (39.5 vs 39.7 degrees C) lower and mirk production (22.6 vs 20.9 kg/day) and efficiency of milk production (1.3 vs 1.2 kg of milk/kg DM ingested) higher than the animals with access to the limited shade. There was no effect on the dry matter intake.
Resumo:
Purpose. This cross-sectional, observational study explored differences among groups staged for intent to decrease dietary fat intake in women with type 2 diabetes in relation to demographic, weight concern, physiological, and psychosocial variables. ^ Methods. A sample of 100 community-dwelling, English-speaking women, who were over age 30 and had type 2 diabetes for at least a year, was accessed through a culturally diverse endocrinology clinic. Subjects completed 7 self-report instruments: demographic sheet, with 11-point weight satisfaction scale; staging algorithm; fat intake (MEDFICTS); depression (CES-D); diabetes-specific dietary knowledge (ADKnowl), social support and self-efficacy scales (SE-Type 2). Physiological variables were abstracted from the medical record (HbA 1c, blood pressure, serum cholesterol and triglycerides). ^ Results. The women's average age was 57.69 years ( SD = 3.07); 50% were married. Subjects were well-educated ( M = 14 years; SD = 3.33), with average diabetes duration of 10.57 years (SD = 9.11), high body mass index (M = 35.72; SD = 8.36), low diabetes-specific dietary knowledge, low weight satisfaction, but in good diabetes control. Racial/ethnic composition was 44% non-Hispanic-White-American, 18% Hispanic-White-American, 15% non-Hispanic-African-American, 16% Hispanic-African-American and 5% other. Fat intake was low and differed by racial/ethnic demographics. The highest fat intake scores were for non-Hispanic-African-Americans (M = 53), followed by Hispanic-White-Americans (M = 51), non-Hispanic-White-Americans (M = 45), and Hispanic-African-Americans (M = 32), who had the lowest fat intake scores. ^ MANOVA analyses revealed no significant differences between stages of behavior change in relation to psychosocial or weight concern variables, age, education, HbA1c, or cholesterol levels. Single women were more likely to be in the three preaction stages (precontemplation, contemplation, and preparation); married women were equally distributed across stages (the preaction stages plus action and maintenance). African-American women (Hispanic and non-Hispanic) were more likely in contemplation and preparation. Triglycerides were higher in women in the action stage than contemplation or preparation. Systolic blood pressure was higher in action than preparation; diastolic blood pressure was higher in action than preaction. ^ Conclusions. Healthcare professionals should consider race, ethnicity, and marital status in client interactions. Dietary intake can vary according to both race and ethnicity; collapsing racial/ethnic groups can alter means and distributions, generating faulty conclusions. Further research is warranted to explore relationships between dietary self-care and marital status, race, ethnicity, and physiological variables. ^
Resumo:
Bariatric surgery is considered an effective method for sustained weight loss, but may cause various nutritional complications. The aim of this study was to evaluate the nutritional status of minerals and vitamins, food consumption, and to monitor physiologic parameters in patients with obesity before and 6 months after Roux-en-Y gastric bypass surgery (RYGB). Thirty-six patients who had undergone RYGB were prospectively evaluated before and 6 months after surgery. At each phase their weight, height, body mass index (BMI), Electro Sensor Complex (ES Complex) data, food consumption, and total protein serum levels, albumin, prealbumin, parathyroid hormone (PTH), zinc (Zn), B12 vitamin (VitB12), iron (Fe), ferritin, copper (Cu), ionic calcium (CaI), magnesium (Mg), and folic acid were assessed. The mean weight loss from baseline to 6 months after surgery was 35.34±4.82%. Markers of autonomic nervous system balance (P<.01), stiffness index (P<.01), standard deviation of normal-to-normal R-R intervals (SDNN) (P<.01), and insulin resistance (P<.001) were also improved. With regard to the micronutrients measured, 34 patients demonstrated some kind of deficiency. There was a high percentage of Zn deficiency in both pre- (55.55%) and postoperative (61.11%) patients, and 33.33% of the patients were deficient in prealbumin postoperatively. The protein intake after 6 months of surgery was below the recommended intake (<70 g/d) for 88.88% of the patients. Laboratory analyses demonstrated an average decrease in total protein (P<.05), prealbumin (P = .002), and PTH (P = .008) between pre- and postsurgery, and a decrease in the percentage of deficiencies for Mg (P<.05), CaI (P<.05), and Fe (P = .021). Despite improvements in the autonomic nervous system balance, stiffness index markers and insulin resistance, we found a high prevalence of hypozincemia at 6 months post-RYGB. Furthermore, protein supplements were needed to maintain an adequate protein intake up to 6 months postsurgery.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.
Resumo:
The development of new drugs is one strategy for malaria control. Biochemical pathways localised in the apicoplast of the parasite, such as the synthesis of isoprenic precursors, are excellent targets because they are different or absent in the human host. Isoprenoids are a large and highly diverse group of natural products with many functions and their synthesis is essential for the parasite's survival. During the last few years, the genes, enzymes, intermediates and mechanisms of this biosynthetic route have been elucidated. In this review, we comment on some aspects of the methylerythritol phosphate pathway and discuss the presence of diverse isoprenic products such as dolichol, ubiquinone, carotenoids, menaquinone and isoprenylated proteins, which are biosynthesised during the intraerythrocytic stages of Plasmodium falciparum.
Resumo:
Stages of change assess individual motivation for lifestyle changes, contributing to the development of more effective intervention strategies. The objective of the present study was to identify factors associated with stages of change for lower intake of red meat and higher intake of vegetables in a cross-sectional analysis of 578 Japanese-Brazilians aged 30-90 years. In adjusted logistic regression models, the odds ratios for women (OR = 1.89; 95%CI: 1.154; 3.103) and physically active individuals (OR = 1.00; 95%CI: 1.000; 1.001) were positively associated with stage of "action" for the higher intake of vegetables. Inverse associations were observed between central obesity (OR = 0.5; 95%CI: 0.351; 0.887) and highest tertile of red meat intake (OR = 0.50; 95%CI: 0.302; 0.817), as well as a positive association between age (OR = 1.04; 95%CI: 1.020; 1.070) and the stage of "action" to the lower intake of meat were verified. Motivation for Japanese-Brazilians to change their food intake was linked to lifestyle. Stage of change is an important factor in mediating food intake behavior change.
Resumo:
We present K-band spectra of the near infrared counterparts to IRS 2E and IRS 2W which is associated with the ultracompact H II region W51d, both of them embedded sources in the Galactic compact H II region W51 IRS 2. The high spatial resolution observations were obtained with the laser guide star facility and Near-infrared Integral Field Spectrograph (NIFS) mounted at the Gemini-North observatory. The spectrum of the ionizing source of W51d shows the photospheric features N III ( 21155 angstrom) in emission and He II ( 21897 angstrom) in absorption which lead us to classify it as a young O3 type star. We detected CO overtone in emission at 23000 angstrom in the spectrum of IRS 2E, suggesting that it is a massive young object still surrounded by an accretion disk, probably transitioning from the hot core phase to an ultracompact H II region.
Resumo:
Context. Compact groups of galaxies are entities that have high densities of galaxies and serve as laboratories to study galaxy interactions, intergalactic star formation and galaxy evolution. Aims. The main goal of this study is to search for young objects in the intragroup medium of seven compact groups of galaxies: HCG 2, 7, 22, 23, 92, 100 and NGC 92 as well as to evaluate the stage of interaction of each group. Methods. We used Fabry-Perot velocity fields and rotation curves together with GALEX NUV and FUV images and optical R-band and HI maps. Results. (i) HCG 7 and HCG 23 are in early stages of interaction; (ii) HCG 2 and HCG 22 are mildly interacting; and (iii) HCG 92, HCG 100 and NGC 92 are in late stages of evolution. We find that all three evolved groups contain populations of young blue objects in the intragroup medium, consistent with ages < 100 Myr, of which several are younger than < 10 Myr. We also report the discovery of a tidal dwarf galaxy candidate in the tail of NGC 92. These three groups, besides containing galaxies that have peculiar velocity fields, also show extended HI tails. Conclusions. Our results indicate that the advanced stage of evolution of a group, together with the presence of intragroup HI clouds, may lead to star formation in the intragroup medium. A table containing all intergalactic HII regions and tidal dwarf galaxies confirmed to date is appended.
Resumo:
This study describes the effects of different intensities of UVB radiation on growth and morphology of early development stages of Iridaea cordata in germlings, young gametophytes originated in the laboratory and young fronds collected in the Magellan Strait, Chile. The experiments were carried out during four weeks in controlled conditions of temperature and photoperiod and the results were compared with a control treatment (without UVB). All UVB irradiation treatments caused bleaching and decrease in growth rates of germlings. Additionally, initial upright fronds were not observed in any of the UVB treatments, where as those cultivated in UVB absence developed erect ones in the second week of culture. The young gametophytes exhibited morphological alteration (small number and size of basal ramifications, curling of tips, bleaching and necrosis) and decrease in growth when exposed to UVB radiation. Young fronds collected from the field showed mainly morphological alterations (curling of frond). Morphological alterations in young gametophytes and young fronds of I. cordata could be interpreted as a defense against UVB by reducing the area exposed to radiation. However, high level of UVB radiation can produce irreparable damage, such as necrosis, observed in young gametophytes originated in the laboratory. Finally, the UVB effects on early developmental stages of I. cordata depend on the UVB irradiance and time of exposition.
Resumo:
Wild-caught larvae, attributed to the lobster shrimp Arius serratus, consisting of two zoeal stages and a decapodid (megalopa), are described in detail. Parentage of larvae was ascertained based on geographic distribution of axiideans and gebiideans (= former thalassinideans) within the study area and close morphological resemblance to other congeneric larval stages. Larvae of A. serratus represent the first described 'thalassinidean' larvae from Canadian Atlantic waters and the first for Axiidae within the northwest Atlantic. Among axiidean larvae, those of A. serratus most closely resemble larvae of A. stirhynchus from the eastern Atlantic. Distinct features include the spination of the pleon that set A. serratus zoeae apart from those of most other 'thalassinideans' but that, in combination with a telson very similar to Homarus americanus, contributes to the general resemblance of A. serratus larvae to those of the American lobster. The primary distinction between these taxa is the presence of a chela on the third pereiopod in the latter that is not present in the former. In view of these appendages being prone to loss or damage, other characters that separate these taxa are listed and discussed. Given the uncertain status of some taxa within Axiidae and limited detailed information of larvae with certain parentage, difficulties in delineating the family based on larvae persist, as they do for cladistic analyses using adult morphology and molecular approaches.