968 resultados para pest of temperate fruit


Relevância:

100.00% 100.00%

Publicador:

Resumo:

It is well known that winter chilling is necessary for the flowering of temperate trees. The chilling requirement is a criterion for choosing a species or variety at a given location. Also chemistry products can be used for reducing the chilling-hours needs but make our production more expensive. This study first analysed the observed values of chilling hours for some representative agricultural locations in Spain for the last three decades and their projected changes under climate change scenarios. Usually the chilling is measured and calculated as chilling-hours, and different methods have been used to calculate them (e.g. Richarson et al., 1974 among others) according to the species considered. For our objective North Carolina method (Shaltout and Unrath, 1983) was applied for apples, Utah method (Richardson et al. 1974) for peach and grapevine and the approach used by De Melo-Abreu et al. (2004) for olive trees. The influence of climate change in temperate trees was studied by calculating projections of chilling-hours with climate data from Regional Climate Models (RCMs) at high resolution (25 km) from the European Project ENSEMBLES (http://www.ensembles-eu.org/). These projections will allow for analysing the modelled variations of chill-hours between 2nd half of 20C and 1st half of 21C at the study locations.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Tolype innocens (Burmeister, 1878) is reported for the first time damaging blueberry (Vaccinium ashei) plants in Brazil having the caterpillars feeding on leaves and new shoots. T. innocens biology was studied on blueberry leaves in laboratory conditions and then a fertility life table was elaborated. Developmental time and viability of egg, larval and pupal stages and egg-adult period were 15.0 and 35.3, 33.3 and 84.5, 20.6 and 100, and 69.2 days and 45%, respectively. Average pupal weight was 0.840g for the females and 0.580g for the males. The sex ratio was 0.5. Pre-oviposition and oviposition time lasted 6.34 and 12.1 days, respectively. Mean fecundity was 251 eggs per female. Eggs were laid either individually or in masses. Longevity was 19.0 and 20.0 days for males and females, respectively. T. innocens population increased 47 times per generation, with a mean generation time of 77 days, and a finite rate of increase of 1.02. This data on biological parameters will be useful for establishing control strategies.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This study aimed to evaluate the effects of (g a.i. L-1) abamectin (0.02), carbaryl (1.73), sulphur (4.8), fenitrothion (0.75), methidathion (0.4), and trichlorfon (1.5) on the survival of larvae and pupae, on the oviposition of adults and hatching of eggs from treated Chrysoperla externa third-instar larvae from two different populations (Bento Gonçalves and Vacaria, Rio Grande do Sul State, Brazil). Morphological changes caused by abamectin to eggs laid by C. externa from Vacaria population were evaluated by mean of ultrastructural analysis. The pesticides were applied on glass plates. Distilled water was used as control. For the evaluation of larvae mortality, a fully randomized experimental design in a 2 x 7 (two populations x seven treatments) factorial scheme was used, whereas for the effects of the compounds on oviposition capacity and egg viability, a 2 x 4 factorial scheme was used. Carbaryl, fenitrothion, and methidathion caused 100% mortality of larvae. Abamectin reduced the hatching of eggs from treated third-instar larvae of both populations; however, this pesticide presented highest toxicity on insects from Vacaria. The ultrastructural analysis showed that abamectin caused malformations in micropyle and in chorion external surface of C. externa eggs. Based in the total effect (E), carbaryl, fenitrothion, and methidathion are harmful to C. externa; trichlorfon is harmless to third-instar larvae, while abamectin and sulphur are harmless and slightly harmful to third-instar larvae from Bento Gonçalves and Vacaria, respectively.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

As insects increase in radiotolerance as they develop and usually several developmental stages of the pest may be present in the fresh shipped commodity, it is important to know the radiation susceptibility of the stages of the target insect before the establishment of ionizing radiation quarantine treatments. This study was performed to determine the radiotolerance of eggs of the oriental fruit moth, Grapholita molesta (Busck) (Lepidoptera: Tortricidae), to gamma radiation. This species is considered as one of the most serious worldwide pests for temperate fruits, especially peaches. Eggs (12 h old) were exposed to 0 (control), 25, 35, 50, 75, 100, 125 and 150 Gy of gamma radiation. Surviving larvae were allowed to feed on an artificial diet. Three days after irradiation, it was verified that larvae`s cephalic capsules were significantly affected by gamma radiation, and the estimated mean LD(90) and LD(99) were 66.3 Gy and 125.8 Gy, respectively. Oriental fruit moth eggs revealed to be quite radiosensitive and very low doses as 50 Gy were sufficient to disrupt G. molesta embryogenesis. At 25 Gy, only male adults originated from the surviving larvae and, after mating with untreated fertile females, shown to be sterile. (C) 2010 Elsevier Ltd. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This work was carried out to show the current situation of the temperate fruit crops in São Paulo state, Brazil, with an emphasis on grapes, peaches, apples, plums, nectarines and pears crops. Current economic data of crops, major growing regions, main cultivars produced, as well as the new technologies generated by research are presented. Regarding the grape crop, a decrease in the national production as well as in the major growing states was observed. The main grapes growing centers in São Paulo state are presented, highlighting its peculiarities regarding cultivars, cultural crop management and current researches. A trend has been observed toward increasing Niagara Rosada grape growing area rather than the fine table grape cultivars. It was also observed the adoption of cultural practices, aiming to increase productivity, to improve the fruits quality and to reduce manpower necessity. In terms of stone fruits, peaches are the most widely cultivated in São Paulo state, followed by plums and nectarines. Both for stone fruits crop and for apples and pears crops, statistics and comments are presented on the crops evolution as well as the current researches results and the requirements of these fruit crops in São Paulo state, Brazil.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Mode of access: Internet.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The genetic diversity of three temperate fruit tree phytoplasmas ‘Candidatus Phytoplasma prunorum’, ‘Ca. P. mali’ and ‘Ca. P. pyri’ has been established by multilocus sequence analysis. Among the four genetic loci used, the genes imp and aceF distinguished 30 and 24 genotypes, respectively, and showed the highest variability. Percentage of substitution for imp ranged from 50 to 68% according to species. Percentage of substitution varied between 9 and 12% for aceF, whereas it was between 5 and 6% for pnp and secY. In the case of ‘Ca P. prunorum’ the three most prevalent aceF genotypes were detected in both plants and insect vectors, confirming that the prevalent isolates are propagated by insects. The four isolates known to be hypo-virulent had the same aceF sequence, indicating a possible monophyletic origin. Haplotype network reconstructed by eBURST revealed that among the 34 haplotypes of ‘Ca. P. prunorum’, the four hypo-virulent isolates also grouped together in the same clade. Genotyping of some Spanish and Azerbaijanese ‘Ca. P. pyri’ isolates showed that they shared some alleles with ‘Ca. P. prunorum’, supporting for the first time to our knowledge, the existence of inter-species recombination between these two species.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Thidiazuron (TDZ) is a phenylurea like citokinin on cell division fruit growth and fruit shape in some deciduous fruit trees. The effects of TDZ applied during flowering on apple cultivars 'Gala' and 'Fuji" were evaluated during seven growing seasons with annual applications on the same trees. The effects on pear and kiwi fruit trees were also evaluated. Every year, TDZ significantly increased fruit set and fruit weight on apple trees. The seven-year average of the fruit set from TDZ at 10 mg.L-1 was 112.7% while the control was only 51.3%. TDZ did not affect the number of clusters. The fruit weight increased 7.0% and 18.3% when the trees were sprayed with TDZ at 10 mg.L-1 and 5 mg.L-1, respectively. TDZ also increased fruit yield per tree by 28.7% and 41.8% for the 10 mg.L-1 and 5 mg.L-1 treatments, respectively. TDZ reduced the seed number per fruit and the calcium content in the flesh fruit, but increased the fruit firmness. The fruit set increased significantly on pear cultivar Packm's Triumph treated with TDZ, and reduced the seed numbers per fruit. TDZ applied at 12.5 mg.L-1 increased fruit weight by 47,4% on "Monty" kiwi.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

In the last 30 years world population has increased 70% but per capita global fruit consumption is only 20% higher. Even though tropical and temperate fruit have similar contributions to the 50 kg/person/year of US consumption of fresh fruit, in the last 30 years this has been slightly greater for temperate fruit. Within fruit consumption, the largest expansion has been for organic fruit which increased more than 50% in the 2002-2006 period. The largest expansion of area planted in the 1996-2006 has been for kiwi (29%) and blueberries (20%), while apples (-24%) and sour cherries (-13%) have had the largest reductions. Nearly 50% of the total global volume of fruit is produced by 5 countries: China, USA, Brazil, Italy and Spain. The main producer (China) accounts for 23% of the total. While the main exporters are Spain, USA and Italy, the main importers are Germany, Russia and UK. Demands for the industry have evolved towards quality, food safety and traceability. The industry faces higher productions costs (labor, energy, agrichemicals). The retailers are moving towards consolidation while the customers are changing preferences (food for health). In this context there is greater pressure on growers, processors and retailers. Emerging issues are labor supply, climate change, water availability and sustainability. Recent developments in precision agriculture, molecular biology, phenomics, crop modelling and post harvest physiology should increase yields and quality, and reduce costs for temperate fruit production around the world.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The oriental fruit moth, Grapholita molesta Busck, and fruit flies, Anastrepha fraterculus L., are the important apple pests under Subtropical climate in Southern Brazil, and control is normally accomplished with insecticides. An alternative strategy for the control of G. molesta is mating disruption, through the use of pheromones. Mating disruption strategies using a low density of dispensers (20) per hectare were tested in comparison with conventional pesticides for control of G. molesta in commercial Gala apple orchards in Fraiburgo, SC, for a period of five years. The average field efficiency period of mating disruption formulation over five years was 113 days. In this period the mating interruption index on mating disruption plots was 84.8% over five years. Damage to Gala apples by oriental moth larvae was low (<0.1%) in mating disruption plots but did not differ from conventional plots, except in the third year. The use of mating disruption allowed for an average reduction of 5.2 insecticide treatments per year in Gala orchards during field efficiency period. It was necessary to apply 1.0 and 1.2 applications of insecticide to control of G. molesta and A. fraterculus, respectively. Mating disruption with a low density of diffusers proved to be an effective alternative to conventional methods for control of G. molesta in Gala apple orchards in subtropical climate in southern Brazil.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

ABSTRACT Fertilization of temperate fruit trees, such as grapevine ( Vitis spp.), apple ( Malus domestica), and pear ( Pyrus communis) is an important tool to achive maximum yield and fruit quality. Fertilizers are provided when soil fertility does not allow trees to express their genetic potential, and time and rate of application should be scheduled to promote fruit quality. Grapevine berries, must and wine quality are affected principally by N, that regulate the synthesis of some important compounds, such as anthocyanins, which are responsible for coloring of the must and the wine. Fermenation of the must may stop in grapes with low concentration of N because N is requested in high amount by yeasts. An N excess may increase the pulp to peel ratio, diluting the concentration of anthocyanins and promoting the migration of anthocyanins from berries to the growing plant organs; a decrease of grape juice soluble solid concentration is also expected because of an increase in vegetative growth. Potassium is also important for wine quality contributing to adequate berry maturation, concentration of sugars, synthesis of phenols and the regulation of pH and acidity. In apple and pear, Ca and K are important for fruit quality and storage. Potassium is the most important component of fruit, however, any excess should be avoided and an adequate K:Ca balance should be achieved. Adequate concentration of Ca in the fruit prevents pre- and post-harvest fruit disorders and, at the same time, increases tolerance to pathogens. Although N promotes adequate growth soil N availability should be monitored to avoid excessive N uptake that may decrease fruit skin color and storability.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The coconut mite, Aceria guerreronis Keifer, is one of the main pests of coconut palms (Cocos nucifera) in northeastern Brazil. The objective of this study was to evaluate the levels of the coconut mite and other mites on coconut palms in the state of So Paulo and to estimate the possible role of predatory mites in the control of this pest. The effect of cultivated genotypes and sampling dates on the mite populations was also estimated. We sampled attached fruits, leaflets, inflorescences, and fallen fruits. The coconut mite was the main phytophagous mite found on attached and fallen fruits, with average densities of 110.0 and 20.5 mites per fruit, respectively. The prevalent predatory mites on attached and fallen fruits were Proctolaelaps bulbosus Moraes, Reis & Gondim Jr. and Proctolaelaps bickleyi (Bram), both Melicharidae. On leaflets, the tenuipalpids Brevipalpus phoenicis (Geijsks) and Tenuipalpus coyacus De Leon and the tetranychid Oligonychus modestus (Banks) were the predominant phytophagous mites. On both leaflets and inflorescences, the predominant predatory mites belonged to the Phytoseiidae. Neoseiulus baraki (Athias-Henriot) and Neoseiulus paspalivorus (De Leon), predators widely associated with the coconut mite in northeastern Brazil and several other countries, were not found. The low densities of the coconut mite in So Paulo could be related to prevailing climatic conditions, scarcity of coconut plantations (hampering the dispersion of the coconut mite between fields), and to the fact that some of the genotypes cultivated in the region are unfavorable for its development.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Perimeter-baiting of non-crop vegetation using toxic protein baits was developed overseas as a technique for control of melon fly, Zeugodacus (Zeugodacus) cucurbitae (Coquillett) (formerly Bactrocera (Zeugodacus) cucurbitae), and evidence suggests that this technique may also be effective in Australia for control of local fruit fly species in vegetable crops. Using field cage trials and laboratory reared flies, primary data were generated to support this approach by testing fruit flies' feeding response to protein when applied to eight plant species (forage sorghum, grain sorghum, sweet corn, sugarcane, eggplant, cassava, lilly pilly and orange jessamine) and applied at three heights (1, 1.5 and 2 m). When compared across the plants, Queensland fruit fly, Bactrocera tryoni (Froggatt), most commonly fed on protein bait applied to sugarcane and cassava, whereas more cucumber fly, Zeugodacus (Austrodacus) cucumis (French) (formerly Bactrocera (Austrodacus) cucumis), fed on bait applied to sweet corn and forage sorghum. When protein bait was applied at different heights, B. tryoni responded most to bait placed in the upper part of the plants (2 m), whereas Z. cucumis preferred bait placed lower on the plants (1 and 1.5 m). These results have implications for optimal placement of protein bait for best practice control of fruit flies in vegetable crops and suggest that the two species exhibit different foraging behaviours.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.