1000 resultados para oscillation detection


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Diplomityössä kehitettiin menetelmiä teollisuusprosessien signaalien automaattiseen havainnointiin ja luotiin työkalu tulosten esittämiseen. Työn tarkoituksena on nopeuttaa ja helpottaa prosessin ongelmien ratkaisua luokittelemalla signaalit matemaattisten menetelmien avulla. Koska prosessin mittaussignaalit ovat pääasiassa stokastisia, eli niitä ei voida etukäteen ennustaa, käsitellään signaaleita tilastomatemaattisin keinoin. Työstä rajattiin mittaushistorian käyttö, joten värähtelyiden tunnistus toteutettiin taajuusanalyysin avulla. Korrelaation avulla löydetään samankaltaiset signaalit. Testeissä todettiin, että työssä kehitetyt havainnoinnit toimivat eri näytteenottotaajuuksilla ja työkalun suoritusnopeus todettiin hyväksi. Lopuksi esiteltiin todellinen teollisuusprosessin ongelma ja siihen mahdollisia ratkaisuja.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The power system stabilizers are used to suppress low-frequency electromechanical oscillations and improve the synchronous generator stability limits. This master thesis proposes a wavelet-based power system stabilizer, composed of a new methodology for extraction and compensation of electromechanical oscillations in electrical power systems based on the scaling coefficient energy of the maximal overlap discrete wavelet transform in order to reduce the effects of delay and attenuation of conventional power system stabilizers. Moreover, the wavelet coefficient energy is used for electric oscillation detection and triggering the power system stabilizer only in fault situations. The performance of the proposed power system stabilizer was assessed with experimental results and comparison with the conventional power system stabilizer. Furthermore, the effects of the mother wavelet were also evaluated in this work

Relevância:

30.00% 30.00%

Publicador:

Resumo:

We investigate the utility of nonclassical states of simple harmonic oscillators, particularly a superposition of coherent states, for sensitive force detection. We find that like squeezed states, a superposition of coherent states allows displacement measurements at the Heisenberg limit. Entangling many superpositions of coherent states offers a significant advantage over a single-mode superposition state with the same mean photon number.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Synoptic wind events in the equatorial Pacific strongly influence the El Niño/Southern Oscillation (ENSO) evolution. This paper characterizes the spatio-temporal distribution of Easterly (EWEs) and Westerly Wind Events (WWEs) and quantifies their relationship with intraseasonal and interannual large-scale climate variability. We unambiguously demonstrate that the Madden–Julian Oscillation (MJO) and Convectively-coupled Rossby Waves (CRW) modulate both WWEs and EWEs occurrence probability. 86 % of WWEs occur within convective MJO and/or CRW phases and 83 % of EWEs occur within the suppressed phase of MJO and/or CRW. 41 % of WWEs and 26 % of EWEs are in particular associated with the combined occurrence of a CRW/MJO, far more than what would be expected from a random distribution (3 %). Wind events embedded within MJO phases also have a stronger impact on the ocean, due to a tendency to have a larger amplitude, zonal extent and longer duration. These findings are robust irrespective of the wind events and MJO/CRW detection methods. While WWEs and EWEs behave rather symmetrically with respect to MJO/CRW activity, the impact of ENSO on wind events is asymmetrical. The WWEs occurrence probability indeed increases when the warm pool is displaced eastward during El Niño events, an increase that can partly be related to interannual modulation of the MJO/CRW activity in the western Pacific. On the other hand, the EWEs modulation by ENSO is less robust, and strongly depends on the wind event detection method. The consequences of these results for ENSO predictability are discussed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Alpha oscillatory activity has long been associated with perceptual and cognitive processes related to attention control. The aim of this study is to explore the task-dependent role of alpha frequency in a lateralized visuo-spatial detection task. Specifically, the thesis focuses on consolidating the scientific literature's knowledge about the role of alpha frequency in perceptual accuracy, and deepening the understanding of what determines trial-by-trial fluctuations of alpha parameters and how these fluctuations influence overall task performance. The hypotheses, confirmed empirically, were that different implicit strategies are put in place based on the task context, in order to maximize performance with optimal resource distribution (namely alpha frequency, associated positively with performance): “Lateralization” of the attentive resources towards one hemifield should be associated with higher alpha frequency difference between contralateral and ipsilateral hemisphere; “Distribution” of the attentive resources across hemifields should be associated with lower alpha frequency difference between hemispheres; These strategies, used by the participants according to their brain capabilities, have proven themselves adaptive or maladaptive depending on the different tasks to which they have been set: "Distribution" of the attentive resources seemed to be the best strategy when the distribution probability between hemifields was balanced: i.e. the neutral condition task. "Lateralization" of the attentive resources seemed to be more effective when the distribution probability between hemifields was biased towards one hemifield: i.e., the biased condition task.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

El Niño South Oscillation (ENSO) is one climatic phenomenon related to the inter-annual variability of global meteorological patterns influencing sea surface temperature and rainfall variability. It influences human health indirectly through extreme temperature and moisture conditions that may accelerate the spread of some vector-borne viral diseases, like dengue fever (DF). This work examines the spatial distribution of association between ENSO and DF in the countries of the Americas during 1995-2004, which includes the 1997-1998 El Niño, one of the most important climatic events of 20(th) century. Data regarding the South Oscillation index (SOI), indicating El Niño-La Niña activity, were obtained from Australian Bureau of Meteorology. The annual DF incidence (AIy) by country was computed using Pan-American Health Association data. SOI and AIy values were standardised as deviations from the mean and plotted in bars-line graphics. The regression coefficient values between SOI and AIy (rSOI,AI) were calculated and spatially interpolated by an inverse distance weighted algorithm. The results indicate that among the five years registering high number of cases (1998, 2002, 2001, 2003 and 1997), four had El Niño activity. In the southern hemisphere, the annual spatial weighted mean centre of epidemics moved southward, from 6° 31' S in 1995 to 21° 12' S in 1999 and the rSOI,AI values were negative in Cuba, Belize, Guyana and Costa Rica, indicating a synchrony between higher DF incidence rates and a higher El Niño activity. The rSOI,AI map allows visualisation of a graded surface with higher values of ENSO-DF associations for Mexico, Central America, northern Caribbean islands and the extreme north-northwest of South America.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.