925 resultados para olfactory detection of conspecifics
Resumo:
Weakly electric fish use electric fields for communication and location of objects. Electroreceptors that are located around the mouth and along the length of the body are used in order to "decode" the electric organ discharge (EOD). The knollenorgan in Mormyriformes aids in distinguishing between different EODs. Gymnotiformes, however, have no such electroreceptors. How then are Gyrnnotiformes distinguishing between conspecific EODs? In this study scan sampling was investigated to determine whether Gymnotus carapo uses this mechanism to differentiate between distinct EODs. After determining whether Gymnotus carapo was discriminating between neighbor and stranger EODs, these same EODs were played to the test fish either jittered (the EOD of the test fish and that of the playback could not coincide) or non-jittered (the two EODs could coincide). The results show that the test fish was not discriminating between neighbor and stranger EODs. Thus, conclusions about the use of scan sampling by Gymnotus carapo to distinguish between EODs cannot be made.
Resumo:
Mice show urinary scent marking behavior as a form of social communication. Marking to a conspecific stimulus mouse or odor varies with stimulus familiarity, indicating discrimination of novel and familiar animals. This study investigated Fos immunoreactivity in inbred C57BL/6J (C57) males following scent marking behavior in response to detection of a social stimulus, or discrimination between a familiar and an unfamiliar conspecific. In Experiment 1 C57 mice were exposed for four daily trials to an empty chamber; on a test day they were exposed to the same chamber or to a male CD-1 mouse in that chamber. Increased scent marking to the CD-1 mouse was associated with increased Fos-immunoreactive cells in the basolateral amygdala, medial amygdala, and dorsal and ventral premammillary nuclei. In Experiment 2 C57 mice were habituated to a CD-1 male for 4 consecutive days and, on the 5th day, exposed to the same CD-1 male, or to a novel CD-1 male. Mice exposed to a novel CD-1 displayed a significant increase in scent marking compared to their last exposure to the familiar stimulus, indicating discrimination of the novelty of this social stimulus. Marking to the novel stimulus was associated with enhanced activation of several telencephalic, as well as hypothalamic and midbrain, structures in which activation had not been seen in the detection paradigm (Experiment 1). These included medial prefrontal and piriform cortices, and lateral septum; the paraventricular nuclei, ventromedial nuclei, and lateral area of the hypothalamus, and the ventrolateral column of the periaqueductal gray. These data suggest that a circumscribed group of structures largely concerned with olfaction is involved in detection of a conspecific olfactory stimulus, whereas discrimination of a novel vs. a familiar conspecific stimulus engages a wider range of forebrain structures encompassing higher-order processes and potentially providing an interface between cognitions and emotions. (C) 2009 IBRO. Published by Elsevier Ltd. All rights reserved.
Resumo:
The diagnosis of idiopathic Parkinson's disease (IPD) is entirely clinical. The fact that neuronal damage begins 5-10 years before occurrence of sub-clinical signs, underlines the importance of preclinical diagnosis. A new approach for in-vivo pathophysiological assessment of IPD-related neurodegeneration was implemented based on recently developed neuroimaging methods. It is based on non- invasive magnetic resonance data sensitive to brain tissue property changes that precede macroscopic atrophy in the early stages of IPD. This research aims to determine the brain tissue property changes induced by neurodegeneration that can be linked to clinical phenotypes which will allow us to create a predictive model for early diagnosis in IPD. We hypothesized that the degree of disease progression in IPD patients will have a differential and specific impact on brain tissue properties used to create a predictive model of motor and non-motor impairment in IPD. We studied the potential of in-vivo quantitative imaging sensitive to neurodegeneration- related brain tissue characteristics to detect changes in patients with IPD. We carried out methodological work within the well established SPM8 framework to estimate the sensitivity of tissue probability maps for automated tissue classification for detection of early IPD. We performed whole-brain multi parameter mapping at high resolution followed by voxel-based morphometric (VBM) analysis and voxel-based quantification (VBQ) comparing healthy subjects to IPD patients. We found a trend demonstrating non-significant tissue property changes in the olfactory bulb area using the MT and R1 parameter with p<0.001. Comparing to the IPD patients, the healthy group presented a bilateral higher MT and R1 intensity in this specific functional region. These results did not correlate with age, severity or duration of disease. We failed to demonstrate any changes with the R2* parameter. We interpreted our findings as demyelination of the olfactory tract, which is clinically represented as anosmia. However, the lack of correlation with duration or severity complicates its implications in the creation of a predictive model of impairment in IPD.
Resumo:
Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)
Resumo:
In this thesis two approaches were applied to achieve a double general objective. The first chapter was dedicated to the study of the distribution of the expression of genes of several bitter and fat receptor in several gastrointestinal tracts. A set of 7 genes for bitter taste and for 3 genes for fat taste was amplified with real-time PCR from mRNA extracted from 5 gastrointestinal segments of weaned pigs. The presence of gene expression for several chemosensing receptors for bitter and fat taste in different compartments of the stomach confirms that this organ should be considered a player for the early detection of bolus composition. In the second chapter we investigated in young pigs the distribution of butyrate-sensing olfactory receptor (OR51E1) receptor along the GIT, its relation with some endocrine markers, its variation with age, and after interventions affecting the gut environment and intestinal microbiota in piglets and in different tissues. Our results indicate that OR51E1 is strictly related to the normal GIT enteroendocrine activity. In the third chapter we investigated the differential gene expression between oxyntic and pyloric mucosa in seven starter pigs. The obtained data indicate that there is significant differential gene exression between oxintic of the young pig and pyloric mucosa and further functional studies are needed to confirm their physiological importance. In the last chapter, thymol, that has been proposed as an oral alternative to antibiotics in the feed of pigs and broilers, was introduced directly into the stomach of 8 weaned pigs and sampled for gastric oxyntic and pyloric mucosa. The analysis of the whole transcript expression shoes that the stimulation of gastric proliferative activity and the control of digestive activity by thymol can influence positively gastric maturation and function in the weaned pigs.
Resumo:
An unusual feature of the mammalian genome is the number of genes exhibiting monoallelic expression. Recently random monoallelic expression of autosomal genes has been reported for olfactory and Ly-49 NK receptor genes, as well as for Il-2, Il-4 and Pax5. RNA fluorescence in situ hybridization (FISH) has been exploited to monitor allelic expression by visualizing the number of sites of transcription in individual nuclei. However, the sensitivity of this technique is difficult to determine for a given gene. We show that by combining DNA and RNA FISH it is possible to control for the hybridization efficiency and the accessibility and visibility of fluorescent probes within the nucleus.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.
Resumo:
Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.
Resumo:
The Indirect Fluorescence Assay (IFA) and the indirect ELISA were comparatively used to detect IgG and IgM antibodies for Toxoplasma gondii in experimentally and naturally infected primates. In the experimentally infected group, antibodies of diagnostic value were detected at day 9 post-infection (PI) with the IFA (IgG and IgM) and with IgG-ELISA. IgM-ELISA detected antibodies for T. gondii starting at day 3 PI until the end of the experiment (102 days PI). Of the 209 naturally infected sera tested, from many zoos of State of Sao Paulo, 64.59 and 67.94% were positive in the IgG-IFA test and IgG-ELISA respectively. IgM-ELISA test detected seropositivity in 52.63% of the sera although IgM-IFA test detected it in only in 0.96% of the samples. The differential toxoplasmosis diagnosis was accomplished with Neospora caninum by IFA, observing 61 (29.2%) seropositive animals for this parasite and 149 (70.8%) negative. Sixty animals were positive for both T. gondii and N. caninum. Pneumonia, splenomegaly, and intestinal ulcers were macroscopically observed. Unremarkable interstitial pneumonia, enteritis, colitis, splenitis, and glomerulitis were microscopically observed. The immunohistochemical stain could not detect the presence of T. gondii in the tissues of the animals infected experimentally.
Resumo:
Bovine coronavirus (BCoV) is a member of the group 2 of the Coronavirus (Nidovirales: Coronaviridae) and the causative agent of enteritis in both calves and adult bovine, as well as respiratory disease in calves. The present study aimed to develop a semi-nested RT-PCR for the detection of BCoV based on representative up-to-date sequences of the nucleocapsid gene, a conserved region of coronavirus genome. Three primers were designed, the first round with a 463bp and the second (semi-nested) with a 306bp predicted fragment. The analytical sensitivity was determined by 10-fold serial dilutions of the BCoV Kakegawa strain (HA titre: 256) in DEPC treated ultra-pure water, in fetal bovine serum (FBS) and in a BCoV-free fecal suspension, when positive results were found up to the 10-2, 10-3 and 10-7 dilutions, respectively, which suggests that the total amount of RNA in the sample influence the precipitation of pellets by the method of extraction used. When fecal samples was used, a large quantity of total RNA serves as carrier of BCoV RNA, demonstrating a high analytical sensitivity and lack of possible substances inhibiting the PCR. The final semi-nested RT-PCR protocol was applied to 25 fecal samples from adult cows, previously tested by a nested RT-PCR RdRp used as a reference test, resulting in 20 and 17 positives for the first and second tests, respectively, and a substantial agreement was found by kappa statistics (0.694). The high sensitivity and specificity of the new proposed method and the fact that primers were designed based on current BCoV sequences give basis to a more accurate diagnosis of BCoV-caused diseases, as well as to further insights on protocols for the detection of other Coronavirus representatives of both Animal and Public Health importance.