Lie detection and children: Impact of the mode of presentation

Although a great deal of research has examined lie-detection among adults, little research has examined the differences between audio and visual mediums for deception among children. In the current study participants were presented (n = 42) with recordings of four children, each describing his/her experience of getting glasses. Two of the accounts were truthful, two were fabricated. Half of the participants were presented with videos, half were presented with audio-recordings. Following the presentation of each recording, participants responded to questions regarding the truthfulness of each child’s account. Results showed that when evaluating truth-tellers, participants’ lie-detection accuracy was significantly greater than chance. Within the video condition, non-parents were shown to report significantly more lie-related cues than parents. Several deception cues were shown to be related to lie-detection accuracy.

How private is private information? The ability to spot deception in an economic game

We provide experimental evidence on the ability to detect deceit in a buyer-seller game with asymmetric information. Sellers have private information about the buyer's valuation of a good and sometimes have incentives to mislead buyers. We examine if buyers can spot deception in face-to-face encounters. We vary (1) whether or not the buyer can interrogate the seller, and (2) the contextual richness of the situation. We find that the buyers' prediction accuracy is above chance levels, and that interrogation and contextual richness are important factors determining the accuracy. These results show that there are circumstances in which part of the information asymmetry is eliminated by people's ability to spot deception.

Detecting Deceit – Guessing or Assessing? Study on the Applicability of Veracity Assessment Methods in Human Intelligence

Intelligence from a human source, that is falsely thought to be true, is potentially more harmful than a total lack of it. The veracity assessment of the gathered intelligence is one of the most important phases of the intelligence process. Lie detection and veracity assessment methods have been studied widely but a comprehensive analysis of these methods’ applicability is lacking. There are some problems related to the efficacy of lie detection and veracity assessment. According to a conventional belief an almighty lie detection method, that is almost 100% accurate and suitable for any social encounter, exists. However, scientific studies have shown that this is not the case, and popular approaches are often over simplified. The main research question of this study was: What is the applicability of veracity assessment methods, which are reliable and are based on scientific proof, in terms of the following criteria? o Accuracy, i.e. probability of detecting deception successfully o Ease of Use, i.e. easiness to apply the method correctly o Time Required to apply the method reliably o No Need for Special Equipment o Unobtrusiveness of the method In order to get an answer to the main research question, the following supporting research questions were answered first: What kinds of interviewing and interrogation techniques exist and how could they be used in the intelligence interview context, what kinds of lie detection and veracity assessment methods exist that are reliable and are based on scientific proof and what kind of uncertainty and other limitations are included in these methods? Two major databases, Google Scholar and Science Direct, were used to search and collect existing topic related studies and other papers. After the search phase, the understanding of the existing lie detection and veracity assessment methods was established through a meta-analysis. Multi Criteria Analysis utilizing Analytic Hierarchy Process was conducted to compare scientifically valid lie detection and veracity assessment methods in terms of the assessment criteria. In addition, a field study was arranged to get a firsthand experience of the applicability of different lie detection and veracity assessment methods. The Studied Features of Discourse and the Studied Features of Nonverbal Communication gained the highest ranking in overall applicability. They were assessed to be the easiest and fastest to apply, and to have required temporal and contextual sensitivity. The Plausibility and Inner Logic of the Statement, the Method for Assessing the Credibility of Evidence and the Criteria Based Content Analysis were also found to be useful, but with some limitations. The Discourse Analysis and the Polygraph were assessed to be the least applicable. Results from the field study support these findings. However, it was also discovered that the most applicable methods are not entirely troublefree either. In addition, this study highlighted that three channels of information, Content, Discourse and Nonverbal Communication, can be subjected to veracity assessment methods that are scientifically defensible. There is at least one reliable and applicable veracity assessment method for each of the three channels. All of the methods require disciplined application and a scientific working approach. There are no quick gains if high accuracy and reliability is desired. Since most of the current lie detection studies are concentrated around a scenario, where roughly half of the assessed people are totally truthful and the other half are liars who present a well prepared cover story, it is proposed that in future studies lie detection and veracity assessment methods are tested against partially truthful human sources. This kind of test setup would highlight new challenges and opportunities for the use of existing and widely studied lie detection methods, as well as for the modern ones that are still under development.

Accuracy of social perception: An integration and review of meta-analyses

This review examines the overall accuracy of social perception across several research topics and identifies factors that inf luence the accuracy of social perception. Findings from 14 meta-analyses examining topics such as social/personality judgments, health judgments, legal judgments, and academic/vocational judg-ments were obtained. Social perception accuracy was generally moderate, yielding an average effect size (r) of .32. However, individual meta-analytic effects varied widely, with some topics yielding small effects (e.g., lie detection, eyewitness identification) and other topics yielding large effects (e.g., educational judgments, health judgments). Several moderators of social perception accuracy were identified, includ-ing the nature of the information source, familiarity of the target, type of personality trait, and severity of the outcome being judged. These findings provide a comprehensive summary and novel integration of disparate findings on the accuracy of social perception. Concluding remarks highlight avenues for future research and call for cross-disciplinary collaborations that would enhance our understanding of social perception.

Detecting deception: Identifying differences in liars' and truth tellers' verbal strategies

Deception research has traditionally focused on three methods of identifying liars and truth tellers: observing non-verbal or behavioral cues, analyzing verbal cues, and monitoring changes in physiological arousal during polygraph tests. Research shows that observers are often incapable of discriminating between liars and truth tellers with better than chance accuracy when they use these methods. One possible explanation for observers' poor performance is that they are not properly applying existing lie detection methods. An alternative explanation is that the cues on which these methods — and observers' judgments — are based do not reliably discriminate between liars and truth tellers. It may be possible to identify more reliable cues, and potentially improve observers' ability to discriminate, by developing a better understanding of how liars and truth tellers try to tell a convincing story. ^ This research examined (a) the verbal strategies used by truthful and deceptive individuals during interviews concerning an assigned activity, and (b) observers' ability to discriminate between them based on their verbal strategies. In Experiment I, pre-interview instructions manipulated participants' expectations regarding verifiability; each participant was led to believe that the interviewer could check some types of details, but not others, before deciding whether the participant was being truthful or deceptive. Interviews were then transcribed and scored for quantity and type of information provided. In Experiment II, observers listened to a random sample of the Experiment I interviews and rendered veracity judgments; half of the observers were instructed to judge the interviews according to the verbal strategies used by liars and truth tellers and the other half were uninstructed. ^ Results of Experiment I indicate that liars and truth tellers use different verbal strategies, characterized by a differential amount of detail. Overall, truthful participants provided more information than deceptive participants. This effect was moderated by participants' expectations regarding verifiability such that truthful participants provided more information only with regard to verifiable details. Results of Experiment II indicate that observers instructed about liars' and truth tellers' verbal strategies identify them with greater accuracy than uninstructed observers. ^

The Effect of Cognitive Load on Deception

The current study applied classic cognitive capacity models to examine the effect of cognitive load on deception. The study also examined whether the manipulation of cognitive load would result in the magnification of differences between liars and truth-tellers. In the first study, 87 participants engaged in videotaped interviews while being either deceptive or truthful about a target event. Some participants engaged in a concurrent secondary task while being interviewed. Performance on the secondary task was measured. As expected, truth tellers performed better on secondary task items than liars as evidenced by higher accuracy rates. These results confirm the long held assumption that being deceptive is more cognitively demanding than being truthful. In the second part of the study, the videotaped interviews of both liars and truth-tellers were shown to 69 observers. After watching the interviews, observers were asked to make a veracity judgment for each participant. Observers made more accurate veracity judgments when viewing participants who engaged in a concurrent secondary task than when viewing those who did not. Observers also indicated that participants who engaged in a concurrent secondary task appeared to think harder than participants who did not. This study provides evidence that engaging in deception is more cognitively demanding than telling the truth. As hypothesized, having participants engage in a concurrent secondary task led to the magnification of differences between liars and truth tellers. This magnification of differences led to more accurate veracity rates in a second group of observers. The implications for deception detection are discussed.

Detection of the movement of the humerus during daily activity.

A new ambulatory technique for qualitative and quantitative movement analysis of the humerus is presented. 3D gyroscopes attached on the humerus were used to recognize the movement of the arm and to classify it as flexion, abduction and internal/external rotations. The method was first validated in a laboratory setting and then tested on 31 healthy volunteer subjects while carrying the ambulatory system during 8 h of their daily life. For each recording, the periods of sitting, standing and walking during daily activity were detected using an inertial sensor attached on the chest. During each period of daily activity the type of arm movement (flexion, abduction, internal/external rotation) its velocity and frequency (number of movement/hour) were estimated. The results showed that during the whole daily activity and for each activity (i.e. walking, sitting and walking) the frequency of internal/external rotation was significantly higher while the frequency of abduction was the lowest (P < 0.009). In spite of higher number of flexion, abduction and internal/external rotation in the dominant arm, we have not observed in our population a significant difference with the non-dominant arm, implying that in healthy subjects the arm dominance does not lie considerably on the number of movements. As expected, the frequency of the movement increased from sitting to standing and from standing to walking, while we provide a quantitative value of this change during daily activity. This study provides preliminary evidence that this system is a useful tool for objectively assessing upper-limb activity during daily activity. The results obtained with the healthy population could be used as control data to evaluate arm movement of patients with shoulder diseases during daily activity.

The Illinois Detection of Deception Examiners Act.

Description based on: 1985; title from cover.

Detection and Classification of Whale Acoustic Signals

This dissertation focuses on two vital challenges in relation to whale acoustic signals: detection and classification.

In detection, we evaluated the influence of the uncertain ocean environment on the spectrogram-based detector, and derived the likelihood ratio of the proposed Short Time Fourier Transform detector. Experimental results showed that the proposed detector outperforms detectors based on the spectrogram. The proposed detector is more sensitive to environmental changes because it includes phase information.

In classification, our focus is on finding a robust and sparse representation of whale vocalizations. Because whale vocalizations can be modeled as polynomial phase signals, we can represent the whale calls by their polynomial phase coefficients. In this dissertation, we used the Weyl transform to capture chirp rate information, and used a two dimensional feature set to represent whale vocalizations globally. Experimental results showed that our Weyl feature set outperforms chirplet coefficients and MFCC (Mel Frequency Cepstral Coefficients) when applied to our collected data.

Since whale vocalizations can be represented by polynomial phase coefficients, it is plausible that the signals lie on a manifold parameterized by these coefficients. We also studied the intrinsic structure of high dimensional whale data by exploiting its geometry. Experimental results showed that nonlinear mappings such as Laplacian Eigenmap and ISOMAP outperform linear mappings such as PCA and MDS, suggesting that the whale acoustic data is nonlinear.

We also explored deep learning algorithms on whale acoustic data. We built each layer as convolutions with either a PCA filter bank (PCANet) or a DCT filter bank (DCTNet). With the DCT filter bank, each layer has different a time-frequency scale representation, and from this, one can extract different physical information. Experimental results showed that our PCANet and DCTNet achieve high classification rate on the whale vocalization data set. The word error rate of the DCTNet feature is similar to the MFSC in speech recognition tasks, suggesting that the convolutional network is able to reveal acoustic content of speech signals.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.