A novel DNA intercalator, butylamino-pyrimido[4',5':4,5]selenolo(2,3-b)quinoline, induces cell cycle arrest and apoptosis in leukemic cells

DNA intercalators are one of the most commonly used chemotherapeutic agents. Novel intercalating compounds of pyrimido[4',5':4,5]selenolo(2,3-b)quinoline series having a butylamino or piperazino group at fourth position (BPSQ and PPSQ, respectively) are studied. Our results showed that BPSQ induced cytotoxicity whereas PPSQ was cytostatic. The cytotoxicity induced by BPSQ was concentration- and time-dependent. Cell cycle analysis and tritiated thymidine assay revealed that BPSQ affects the cell cycle progression by arresting at S phase. The absence of p-histone H3 and reduction in the levels of PCNA in the cells treated with BPSQ further confirmed the cell cycle arrest. Further, annexin V staining, DNA fragmentation, nuclear condensation and changes in the expression levels of BCL2/BAD confirmed the activation of apoptosis. Activation of caspase 8 and lack of cleavage of caspase 9, caspase 3 and PARP suggest the possibility of BPSQ triggering extrinsic pathway for induction of apoptosis, which is discussed. Hence, we have identified a novel compound which would have clinical relevance in cancer chemotherapeutics.

A novel DNA intercalator, 8-methoxy pyrimido4 `,5 `:4,5]thieno (2,3-b)quinoline-4(3H)-one induces apoptosis in cancer cells, inhibits the tumor progression and enhances lifespan in mice with tumor

Polycyclic aromatic molecules such as ellipticine intercalate into double-stranded DNA and interfere with physiological functions. In the present study, we evaluate the chemotherapeutic potential of MPTQ on animal models and its mode of action. In order to test the antitumor activity, monohydrochloride of MPTQ was orally administered in mice bearing tumor. Results showed a significant inhibition of tumor growth compared to that of untreated controls. More importantly, mean lifespan of tumor bearing animals treated with MPTQ was significantly higher as compared to that of untreated tumor bearing mice suggesting that the treatment affected viability of cancerous cells, but not of normal cells. Consistent with this, we find that administration of MPTQ to normal mice did not cause any major side effects as observed upon hematological and serum profiling. We also found that MPTQ induces cytotoxicity in cancer cell lines, by activating apoptosis both by intrinsic and extrinsic pathways. Thus, MPTQ could be used as a potential cancer therapeutic agent.

A novel DNA intercalator, 8-methoxy pyrimido4 `,5 `:4,5]thieno (2,3-b)quinoline-4(3H)-one induces apoptosis in cancer cells, inhibits the tumor progression and enhances lifespan in mice with tumor

Polycyclic aromatic molecules such as ellipticine intercalate into double-stranded DNA and interfere with physiological functions. In the present study, we evaluate the chemotherapeutic potential of MPTQ on animal models and its mode of action. In order to test the antitumor activity, monohydrochloride of MPTQ was orally administered in mice bearing tumor. Results showed a significant inhibition of tumor growth compared to that of untreated controls. More importantly, mean lifespan of tumor bearing animals treated with MPTQ was significantly higher as compared to that of untreated tumor bearing mice suggesting that the treatment affected viability of cancerous cells, but not of normal cells. Consistent with this, we find that administration of MPTQ to normal mice did not cause any major side effects as observed upon hematological and serum profiling. We also found that MPTQ induces cytotoxicity in cancer cell lines, by activating apoptosis both by intrinsic and extrinsic pathways. Thus, MPTQ could be used as a potential cancer therapeutic agent. (c) 2011 Wiley Periodicals, Inc.

Role of hydrophobic effect and surface charge in surfactant-DNA association

Ethidium bromide is one of the best known DNA intercalator. Upon intercalation inside DNA, the fluorescence due to ethidium bromide gets enhanced by many orders of magnitude. In this paper, we employed ethidium bromide as a probe for studying surfactant-DNA complexation using fluorescence spectroscopy and agarose gel electrophoresis. Surfactants of different charge types and chain lengths were used and the results were compared with that of the related small organic cations or salts under comparable conditions. The cationic surfactants induced destabilization of the ethidium bromide-DNA complex at concentrations in orders of magnitude lower than that of the small organic cations or salts. In contrast however, the anionic surfactants failed to promote any such destabilization of probe-DNA complex. DNA loses its ethidium bromide stainability in the presence of high concentration of cationic surfactant aggregates as revealed from agarose gel electrophoresis experiments. Inclusion of surfactants and other additives into the DNA generally enhanced the DNA double-strand to single strand transition melting temperatures by a few degrees, in a concentration-dependent manner and at high surfactant concentration melting profiles got broadened.

Chemistry and biology of DNA-binding small molecules

Regulation of the transcription machinery is one of the many ways to achieve control of gene expression. This has been done either at the transcription initiation stage or at the elongation stage. Different methodologies are known to inhibit transcription initiation via targeting of double-stranded (ds) DNA by: (i) synthetic oligonucleotides, (ii) ds-DNA-specific, sequenceselective minor-groove binders (distamycin A), intercalators (daunomycin) combilexins and (iii) small molecule (peptide or intercalator)-oligonucleotide conjugates. In some cases, instead of ds-DNA, higher order G-quadruplex structures are formed at the start site of transcription. In this regard G-quadruplex DNA-specific small molecules play a significant role towards inhibition of the transcription machinery. Different types of designer DNA-binding agents act as powerful sequence-specific gene modulators, by exerting their effect from transcription regulation to gene modification. But most of these chemotherapeutic agents have serious side effects. Accordingly, there is always a challenge to design such DNA-binding molecules that should not only achieve maximum specific DNA-binding affinity, and cellular and nuclear transport activity, but also would not interfere with the functions of normal cells.

DNA intercalative 4-butylaminopyrimido4',5':4,5]thieno(2,3-b)quinoline induces cell cycle arrest and apoptosis in leukemia cells

DNA intercalators are one of the interesting groups in cancer chemotherapy. The development of novel anticancer small molecule has gained remarkable interest over the last decade. In this study, we synthesized and investigated the ability of a tetracyclic-condensed quinoline compound, 4-butylaminopyrimido4',5':4,5]thieno(2,3-b)quinoline (BPTQ), to interact with double-stranded DNA and inhibit cancer cell proliferation. Circular dichroism, topological studies, molecular docking, absorbance, and fluorescence spectral titrations were employed to study the interaction of BPTQ with DNA. Cytotoxicity was studied by performing 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) and lactate dehydrogenase (LDH) assay. Further, cell cycle analysis by flow cytometry, annexin V staining, mitochondrial membrane potential assay, DNA fragmentation, and western blot analysis were used to elucidate the mechanism of action of BPTQ at the cellular level. Spectral, topological, and docking studies confirmed that BPTQ is a typical intercalator of DNA. BPTQ induces dose-dependent inhibitory effect on the proliferation of cancer cells by arresting cells at S and G2/M phase. Further, BPTQ activates the mitochondria-mediated apoptosis pathway, as explicated by a decrease in mitochondrial membrane potential, increase in the Bax:Bcl-2 ratio, and activation of caspases. These results confirmed that BPTQ is a DNA intercalative anticancer molecule, which could aid in the development of future cancer therapeutic agents.

Real-Time Study of Genomic DNA Structural Changes upon Interaction with Small Molecules Using Dual-Polarization Interferometry

The structural changes of genomic DNA upon interaction with small molecules have been studied in real time using dual-polarization interferometry (DPI). Native or thermally denatured DNA was immobilized on the silicon oxynitride surface via a preadsorbed poly(ethylenimine) (PEI) layer. The mass loading was similar for both types of DNA, however, native DNA formed a looser and thicker layer due to its rigidity, unlike the more flexible denatured DNA, which mixed with PEI to form a denser and thinner layer. Ethidium bromide (EtBr), a classical intercalator, induced the large thickness decrease and density increase of native DNA (double-stranded), but a slight increase in both the thickness and density of denatured DNA (partial single-stranded).

Real-time PCR microfluidic devices with concurrent electrochemical detection

Electrochemistry-based detection methods hold great potential towards development of hand-held nucleic-acid analyses instruments. In this work, we demonstrate the implementation of in situ electrochemical (EC) detection method in a microfluidic flow-through EC-qPCR (FTEC-qPCR) device, where both the amplification of the target nucleic-acid sequence and subsequent EC detection of the PCR amplicon are realized simultaneously at selected PCR cycles in the same device. The FTEC-qPCR device utilizes methylene blue (MB), an electroactive DNA intercalator, for electrochemical signal measurements in the presence of PCR reagent components. Our EC detection method is advantageous, when compared to other existing EC methods for PCR amplicon analysis, since FTEC-qPCR does not require probe-modified electrodes, or asymmetric PCR, or solid-phase PCR. Key technical issues related to surface passivation, electrochemical measurement, PCR inhibition by metal electrode, bubble-free PCR, were investigated. By controlling the concentration of MB and the exposure of PCR mixture to the bare metal electrode, we successfully demonstrated electrochemical measurement of MB in solution-phase, symmetric PCR by amplifying a fragment of lambda phage DNA.

Enthalpy/entropy compensation: Influence of DNA flanking sequence on the binding of 7-amino actinomycin D to its primary binding site in short DNA duplexes

The effect of the context of the flanking sequence on ligand binding to DNA oligonucleotides that contain consensus binding sites was investigated for the binding of the intercalator 7-amino actinomycin D. Seven self-complementary DNA oligomers each containing a centrally located primary binding site, 5'-A-G-C-T-3', flanked on either side by the sequences (AT)(n) or (AA)(n) (with n = 2, 3, 4) and AA(AT)(2), were studied. For different flanking sequences, (AA)(n)-series or (AT)(n)-series, differential fluorescence enhancements of the ligand due to binding were observed. Thermodynamic studies indicated that the flanking sequences not only affected DNA stability and secondary structure but also modulated ligand binding to the primary binding site. The magnitude of the ligand binding affinity to the primary site was inversely related to the sequence dependent stability. The enthalpy of ligand binding was directly measured by isothermal titration calorimetry, and this made it possible to parse the binding free energy into its energetic and entropic terms.

Synteza oraz właściwości fizykochemiczne bis-interkalatorów naftalimidowych

Wydział Chemii

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents

The two enantiomers of [Ru(bpy)2(bbtb)]2+ {bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+ {Me2bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association to hairpin oligonucleotides, again with the lambda enantiomer binding more strongly. A 1H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Benzothiazole bipyridine complexes of ruthenium(II) with cytotoxic activity

A series of benzothiazole-substituted trisbipyridine ruthenium(II) analogues {[Ru(bpy)(2)(4,5'-bbtb)](2+), [Ru(bpy)(2)(5,5'-bbtb)](2+) and [Ru(bpy)(2)(5-mbtb)](2+) [bpy is 2,2'-bipyridine, bbtb is bis(benzothiazol-2-yl)-2,2'-bipyridine, 5-mbtb is 5-(benzothiazol-2-yl),5'-methyl-2,2'-bipyridine]} have been prepared and compared with the complex [Ru(bpy)(2)(4,4'-bbtb)](2+) reported previously. From the UV-vis spectral studies, substitution at the 5-position of the bpy causes the ligand-centred transitions to occur at considerably lower energy than for those with the functionality at the 4-position, while at the same time causing the emission to be effectively quenched. However, substitution at the 4-position causes the metal-to-ligand charge transfer to occur at lower energies. Fluorescent intercalator displacement studies indicate that the doubly substituted complexes displace ethidium bromide from a range of oligonucleotides, with the greater preference shown for bulge and hairpin sequences by the Lambda enantiomer. Since the complexes only show small variation in the UV-vis spectra on the introduction of calf thymus DNA and a small increase in fluorescence they do not appear to be intercalators, but appear to associate within one of the grooves. All of the reported bisbenzothiazole complexes show reasonable cytotoxicity against a range of human cancer cell lines.

Synthesis, structural characterization and catalytic activity of a multifunctional enzyme mimetic oxoperoxovanadium(v) complex

The synthesis and structural characterization of a novel oxoperoxovanadium(v) complex [VO(O-2)(PAH)-(phen)] containing the ligands 2-phenylacetohydroxamic acid (PAHH) and 1,10-phenanthroline (phen) has been accomplished. The oxoperoxovanadium(v) complex was found to mimic both vanadate-dependent haloperoxidase (VHPO) activity as well as nuclease activity through effective interaction with DNA. The complex is the first example of a structurally characterized stable oxoperoxovanadium(v) complex with a coordinated bi-dentate hydroximate moiety (-CONHO-) from 2-phenylacetohydroximate (PAH). The oxoperoxovanadium(v) complex has been used as catalyst for the peroxidative bromination reaction of some unsaturated alcohols (e.g. 4-pentene-1-ol, 1-octene-3-ol and 9-decene-1-ol) in the presence of H2O2 and KBr. The catalytic products have been characterized by GC-MS analysis and spectrophotometric methods. The DNA binding of this complex has been established with CT DNA whereas the DNA cleavage was demonstrated with plasmid DNA. The interactions of the complex with DNA have been monitored by electronic absorption and fluorescence emission spectroscopy. Viscometric measurements suggest that the compound is a DNA intercalator. The nuclease activity of this complex was confirmed by gel electrophoresis studies.

Design, Synthese und biologische Evaluierung von Pyrrolcarboxamiden mit Nucleobasen- oder tricyclischer Aromatenfunktion

Ausgehend von den Naturstoffen Netropsin und Distamycin A, antitumoraktiven Pyrrolcarboxamiden, die selektiv an AT-reiche Sequenzen in der kleinen Rinne (Minor-Groove) der DNA binden, sollten neue Nucleobasen- bzw. Interkalator-gekoppelte Derivate (letztere werden als „Combilexine“ bezeichnet) synthetisiert und biologisch evaluiert werden. Unter Zuhilfenahme quantenchemischer AM1-Rechnungen sollten Struktur-Wirkungs-Beziehungen abgeleitet werden. Als Grundgerüst diente die Mono- bzw. Bispyrrolcarboxamid-Einheit mit C-terminaler N,N-Dimethyl-1,3-diaminopropan-Seitenkette, die die ebenfalls basische Amidinstruktur der Leitsubstanzen imitieren sollte. Variationen erfolgten ausschließlich am N-terminalen Ende. Hierbei wurden zunächst Adenin-, Thymin- und Uracil-alkancarbonsäuren mit variabler Kettenlänge synthetisiert und über verschiedene Amidkupplungsverfahren an die Aminofunktion des Pyrrolcarboxamid-Grundgerüstes geknüpft. In Analogie hierzu folgte die Synthese von Combilexinen mit Acridon, (Nitro-)Naphthalimid und Iminostilben als Interkalatorkomponenten. Im 3. synthetischen Teil der Arbeit wurden Carbonsäure- und Sulfonylchloride des Interkalators Acridin und des Interkalators und Photosensibilisators Anthrachinon über die aliphatischen Linker ß-Alanin und -Aminobuttersäure an das Pyrrolcarboxamidgrundgerüst gebunden. Testungen von Verbindungen aller 3 Serien auf Zytotoxizität beim National Cancer Institute, USA, und DNA-Bindestudien und Topoisomerase-Hemmtests im Laboratory of Pharmacology, INSERM in Lille, Frankreich, schlossen sich an. Bei allen Verbindungen mit mindestens 3 Carboxamid-Funktionen zeigte sich gute bis ausgezeichnete DNA-Bindung; einige wiesen Topoisomerase II - Hemmung auf. Beide Parameter korrelierten allerdings nicht mit der Zytotoxizität, was vor allem an der mangelhaften Zellmembranpermeation einiger Verbindungen aufgrund zu geringer Lipophilie liegen dürfte. Quantenchemische Rechnungen ergaben ebenfalls wenige Gesetzmäßigkeiten. Ein elektronenarmer N-terminaler Rest (wie im Falle des hochpotenten Iminostilben-Derivates) scheint aber die Zytotoxizität einer Substanz ebenso wie zunehmende Linkerlänge zu begünstigen. Eine Ausnahme bilden hier die Anthrachinonderivate. Die drei zytotoxisch aktivsten Vertreter dieser Gruppe besitzen als Linker ß-Alanin, was eine aus der sonst bei Minor-Groove-Bindern üblichen Kurvature herausragende Konformation zur Folge hat. Diese ermöglicht vermutlich eine besonders gute Interaktion mit der DNA.

Protein-free parallel triple-stranded DNA complex formation

A 14 nt DNA sequence 5′-AGAATGTGGCAAAG-3′ from the zinc finger repeat of the human KRAB zinc finger protein gene ZNF91 bearing the intercalator 2-methoxy,6-chloro,9-amino acridine (Acr) attached to the sugar–phosphate backbone in various positions has been shown to form a specific triple helix (triplex) with a 16 bp hairpin (intramolecular) or a two-stranded (intermolecular) duplex having the identical sequence in the same (parallel) orientation. Intramolecular targets with the identical sequence in the antiparallel orientation and a non-specific target sequence were tested as controls. Apparent binding constants for formation of the triplex were determined by quantitating electrophoretic band shifts. Binding of the single-stranded oligonucleotide probe sequence to the target led to an increase in the fluorescence anisotropy of acridine. The parallel orientation of the two identical sequence segments was confirmed by measurement of fluorescence resonance energy transfer between the acridine on the 5′-end of the probe strand as donor and BODIPY-Texas Red on the 3′-amino group of either strand of the target duplex as acceptor. There was full protection from OsO4-bipyridine modification of thymines in the probe strand of the triplex, in accordance with the presumed triplex formation, which excluded displacement of the homologous duplex strand by the probe–intercalator conjugate. The implications of these results for the existence of protein-independent parallel triplexes are discussed.