Transcriptome analysis for discovering candidate genes involve in embryogenesis in coconut (Cocos nucifera L.) through 454 pyrosequencing

Coconut, Cocos nucifera L. is a major plantation crop, which ensures income for millions of people in the tropical region. Detailed molecular studies on zygotic embryo development would provide valuable clues for the identification of molecular markers to improve somatic embryogenesis. Since there is no ongoing genome project for this species, coconut expressed sequence tags (EST) would be an interesting technique to identify important coconut embryo specific genes as well as other functional genes in different biochemical pathways. The goal of this study was to analyse the ESTs by examining the transcriptome data of the different embryo tissue types together with one somatic tissue. Here, four cDNA libraries from immature embryo, mature embryo, microspore derived embryo and mature leaves were constructed. cDNA was sequenced by the Roche-454 GS-FLX system and assembled into 32621 putative unigenes and 155017 singletons. Of these unigenes, 18651 had significant sequence similarities to non-redundant protein database, from which 16153 were assigned to one or more gene ontology categories. Homologue genes, which are responsible for embryo development such as chitinase, beta-1,3-glucanase, ATP synthase CF0 subunit, thaumatin-like protein and metallothionein-like protein were identified among the embryo EST collection. Of the unigenes, 6694 were mapped into 139 KEGG pathways including carbohydrate metabolism, energy metabolism, lipid metabolism, amino acid metabolism and nucleotide metabolism. This collection of 454-derived EST data generated from different tissue types provides a significant resource for genome wide studies and gene discovery of coconut, a non-model species.

Efficiency of In Vitro Regeneration is Dependent on the Genotype and Size of Explant in Tef [Eragrostis tef (Zucc.) Trotter]

Tef [Eragrostis tef (Zucc.) Trotter] is the major cereal crop in the Horn of Africa particularly in Ethiopia where it is staple food for about 50 million people. Its resilience to extreme environmental conditions and high in nutrition makes tef the preferred crop among both farmers and consumers. The efficiency of in vitro regeneration plays significant role in the improvement of crops. We investigated the efficiency of regeneration in 18 tef genotypes (15 landraces and three improved varieties) using three sizes of immature embryos (small, intermediate and large) as an explant. In vitro regeneration was significantly affected by the genotype and the size of the immature embryo used as a donor. Intermediate-size immature embryos which were 101-350 µm long led to the highest percentage of regeneration. Interestingly, the three improved varieties presented very low regeneration efficiencies whereas the landrace Manyi resulted in consistently superior percentage of in vitro regeneration from all three sizes of explants. The findings of this work provide useful insight into the tef germplasm amenable for the regeneration technique which has direct application in techniques such as transformation. It also signifies the importance of using tef landraces instead of improved varieties for in vitro regeneration.

Vitrification of immature feline oocytes with a commercial kit for bovine embryo vitrification

The aim of this study was to evaluate the suitability of a commercial kit for bovine embryo vitrification for cryopreserving cat oocytes and to evaluate comparatively the effects of its use with slow freezing procedure on cryotolerance in terms of morphology and oocyte resumption of meiosis. Germinal vesicle stage oocytes isolated from cat ovaries were either vitrified (n=72) using a vitrification kit for bovine embryo or slow frozen (n=69) by exposing oocyte to ethylene glycol solution before being transferred to a programmable embryo freezer. After thawing and warming, oocytes were cultured for 48h and then were examined for meiosis resumption using bisbenzimide fluorescent staining (Hoechst 33342). Fresh immature oocytes (n=92) were used as the control group. The proportion of oocytes recovered in a morphologically normal state after thawing/warming was significantly higher in frozen oocytes (94.5%) than in the vitrified ones (75%, p<0.01). Morphological integrity after culture was similar in vitrified (73.6%) and slow frozen oocytes (76.8%); however, only 37.5% of the morphologically normal oocytes resumed meiosis after vitrification compared to 60.9% of those submitted to slow freezing procedure (p<0.01). Fresh oocytes showed higher morphological integrity (91.3%) and meiosis resumption rates (82.6%, p<0.002) than cryopreserved oocytes, irrespective of the procedure used. These results suggest that immature cat oocytes vitrified with a kit for bovine embryos retain their capacity to resume meiosis after warming and culture, albeit at lower rates than slow frozen oocytes. Vitrification and slow freezing methods show similar proportions of oocytes with normal morphology after culture, which demonstrate that thawed and warmed oocytes that resist to cryodamage have the same chances to maintain their integrity after 48h of culture. © 2012 Blackwell Verlag GmbH.

Sequential analysis of global gene expression profiles in immature and in vitro matured bovine oocytes: potential molecular markers of oocyte maturation

Background: Without intensive selection, the majority of bovine oocytes submitted to in vitro embryo production (IVP) fail to develop to the blastocyst stage. This is attributed partly to their maturation status and competences. Using the Affymetrix GeneChip Bovine Genome Array, global mRNA expression analysis of immature (GV) and in vitro matured (IVM) bovine oocytes was carried out to characterize the transcriptome of bovine oocytes and then use a variety of approaches to determine whether the observed transcriptional changes during IVM was real or an artifact of the techniques used during analysis. Results: 8489 transcripts were detected across the two oocyte groups, of which similar to 25.0% (2117 transcripts) were differentially expressed (p < 0.001); corresponding to 589 over-expressed and 1528 under-expressed transcripts in the IVM oocytes compared to their immature counterparts. Over expression of transcripts by IVM oocytes is particularly interesting, therefore, a variety of approaches were employed to determine whether the observed transcriptional changes during IVM were real or an artifact of the techniques used during analysis, including the analysis of transcript abundance in oocytes in vitro matured in the presence of a-amanitin. Subsets of the differentially expressed genes were also validated by quantitative real-time PCR (qPCR) and the gene expression data was classified according to gene ontology and pathway enrichment. Numerous cell cycle linked (CDC2, CDK5, CDK8, HSPA2, MAPK14, TXNL4B), molecular transport (STX5, STX17, SEC22A, SEC22B), and differentiation (NACA) related genes were found to be among the several over-expressed transcripts in GV oocytes compared to the matured counterparts, while ANXA1, PLAU, STC1and LUM were among the over-expressed genes after oocyte maturation. Conclusion: Using sequential experiments, we have shown and confirmed transcriptional changes during oocyte maturation. This dataset provides a unique reference resource for studies concerned with the molecular mechanisms controlling oocyte meiotic maturation in cattle, addresses the existing conflicting issue of transcription during meiotic maturation and contributes to the global goal of improving assisted reproductive technology.

An embryo-rescue protocol for Vigna interspecific hybrids

A successful embryo-rescue and culture protocol was developed for use with several indigenous Vigna species and mungbean cultivars grown in Australia. Germination of Vigna immature embryos and their subsequent development into plants was influenced by the time at which the embryos were isolated and by which medium additives were placed in the embryo-rescue medium. A medium containing MS basal nutrients with sucrose (88 mM), casein hydrolysate (500 mg L-1) and agar (8 g L-1) but devoid of plant-growth regulators was found to be the best for germination of immature embryos for all four Vigna species investigated. The protocol for successful germination of non-hybrid immature embryos was applied to the recovery of interspecific hybrids involving mungbean and five native Vigna species that had previously been found difficult to hybridise. Several putative hybrid plants were obtained including a confirmed interspecific cross between V. luteola (Jacq.) Benth and V. marina (Burm.) Merrill.

Carbon sources and polyethylene glycol on soybean somatic embryo conversion

Somatic embryogenesis is an efficient method for the production of target cells for soybean genetic transformation. However, this method still offers low percentages of plant regeneration, and perhaps is related to the maturation process and high morphological abnormalities of the matured embryos. This study aimed to identify a maturation medium that could contribute to the outcome of more efficient plant regeneration results. Embryogenic clusters, derived from cotyledons of immature seeds of the soybean cultivars Bragg and IAS5, were used as starting material for embryos development. Different maturation media were tested by using 6% maltose, 3% sucrose or 6% sucrose, combined with or without 25 g L-1 of the osmotic regulator polyethylene glycol (PEG-8000). The histodifferentiated embryos were quantified and classified in morphological types. Percentages of converted embryos were analyzed. Cultivar Bragg resulted in higher matured embryo quantities, but lower percentages were obtained for the conversion in comparison to cultivar IAS5. While the addition of PEG did not affect the number of embryos converted into plants, 6% sucrose enhanced the conversion percent significantly.

Embryo rescue from interspecific crosses in apple rootstocks

The objetive of this work was to rescue immature embryos of apple rootstocks Malus prunifolia (Marubakaido) and Malus pumila (M9) after 40-60 days of pollination and to put them into MS culture media supplemented with agar (6 g L-1) and casein hydrolysate (500 mg L-1). Embryos originated from interspecific crosses and open pollination showed differences in the in vitro responses, depending on the female parent, the developmental stage of the embryo, and the culture medium composition. Embryos of the M. pumila rootstock, rescued within 40 days after pollination and put in culture medium supplemented with indolacetic acid (IAA), gibberellic acid (GA3), kinetin and maltose, resulted in a normal development of plantlets. However, embryos originating from hand-pollination, cultivated in medium supplemented with 14 µM IAA, 5 µM kinetin and 1.5 µM Ga3 (MS1), mainly those of M. prunifolia x M. pumila, showed a high percentage of rusted embryos (96.2%). Embryos from open pollination of M. prunifolia and M. pumila formed calluses. It was possible to identify the influence of the female parent by the enhanced development of M. pumila shoots derived from open or hand-pollination. The crossing of responsive species and the use of the technique of embryo culture provided a rapid and uniform germination and, consequently, the development of fully normal seedlings.

Comparison of embryo yield and pregnancy rate between in vivo and in vitro methods in the same Nelore (Bos indicus) donor cows

To investigate why the preferred means to produce bovine embryos in Brazil has changed from in vivo to in vitro, we compared these two approaches in the same Nelore cows (n = 30) and assessed total embryo production and pregnancy rates. Without a specific schedule, all cows were subjected to ultrasound-guided ovum pick up (OPU)/in vitro production (IVP) and MOET, with intervals ranging from 15 to 45 d between procedures, respectively. To produce in vivo embryos, cows were superovulated and embryos were recovered nonsurgically from 1 to 3 times (1.4 +/- 0.6). whereas OPU/IVP was repeated from 1 to 5 times (3.2 +/- 1.2) in each donor cow during a 12-mo interval. Embryos obtained from both methods were transferred to crossbred heifers. on average. 25.6 +/- 15.3 immature oocytes were collected per OPU attempt. The average number of embryos produced by OPU/IVP (9.4 +/- 5.3) was higher (P < 0.05) than the MOET method (6.7 +/- 3.7). However, pregnancy rates were lower (P < 0.05) following transfer of IVP (33.5%) versus in vivo-derived embryos (41.5%) embryos. Embryonic losses between Days 30 and 60 and fetal sex ratio were similar (P > 0.05) between in vivo and in vitro-derived embryos. We concluded that in Nelore cows, with an interval of 15 d between OPU procedures, it was possible to produce more embryos and pregnancies compared to conventional MOET. (C) 2009 Elsevier B.V. All rights reserved.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Melatonin in maturation media fails to improve oocyte maturation, embryo development rates and DNA damage of bovine embryos

Melatonin (MEL) acts as a powerful scavenger of free radicals and direct gonadal responses to melatonin have been reported in the literature. Few studies, however, have evaluated the effect of MEL during in vitro maturation (IVM) on bovine embryos. This study tested the addition of MEL to maturation medium (MM) with no gonadotropins on nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos. Cumulus-oocyte complexes were aspirated from abattoir ovaries and cultured in MM (TCM-199 medium supplemented with 10% fetal calf serum - FCS) at 39ºC and 5% CO2 in air. After 24 hours of culture in MM with 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH; 10-9 M MEL) or 10-9 M MEL, 0.5 µg mL-1 FSH and 5.0 µg mL-1 LH, the oocytes were stained with Hoechst 33342 to evaluate nuclear maturation rate. After in vitro fertilization and embryo culture, development rates were evaluated and the blastocysts were assessed for DNA damage by Comet assay. There was no effect of melatonin added to the MM, alone or in combination with gonadotropins, on nuclear maturation, cleavage and blastocyst rates. These rates ranged between 88% to 90%, 85% to 88% and 42% to 46%, respectively. The extent of DNA damage in embryos was also not affected by MEL supplementation during IVM. The addition of 10-9 M MEL to the MM failed to improve nuclear maturation and embryo development rates and the incidence of DNA damage in resulting embryos, but was able to properly substitute for gonadotropins during IVM.

Immature stages of the moth Lobeza dentilinea (Lepidoptera: Notodontidae), with redescription of the species based on male and female morphology

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Influence of Caffeine and Chondroitin Sulfate on Swine Sperm Capacitation and In Vitro Embryo Production

Background: The establishment of an in vitro production (IVP) of embryo in swine allows the generation of embryos with the same quality as in vivo produced embryos with less costs and time. In order to achieve successful fertilization under normal circumstances in vivo, mammalian spermatozoa must first undergo capacitation and then acrosome reaction. The purpose of this study was compared the efficacious of IP/CFDA fluorescence and Coomassie Blue G (CB) staining to detect capacitated sperm cells in refrigerated and fresh semen. Morever, it was investigated the efficacious of caffeine and chondroitin sulphate to promote in vitro sperm capacitation and in vitro embryo produced (IVP) of swine embryos. Materials, Methods & Results: A sperm-rich fraction from ejaculate was obtained using the gloved-hand method and the gel-free fraction was separated using sterile gauze. The semen was diluted in BTS at a final concentration of 1.5 x 10(8) cells/mL. The sperm suspension was incubated for 2 h at 25 degrees C, refrigerated and maintained for 1 h at 15-18 degrees C (refrigerated group) or used immediately (fresh group). Sperm capacitation was assessed by IP/CFDA fluorescence and CB staining for both fresh and refrigerated semen. For PI/CFDA evaluation, a final solution containing 1.7 mM formaldehyde, 7.3 mM PI and 20 mM CFDA in 950 mu L saline was prepared. In the dark, 40 mu L PI/CFDA final solution was added to 10 mu L semen and after 8 min, slides were analyzed on epifluorescence microscopy. For CB evaluation, sperm cells were fixed in 4% paraformaldehyde for 10 min and centrifuged twice at 320 x g in ammonium acetate pH 9 for 8 min. A smear was made and stained with 2.75 mg/mL CB in solution containing 12.5% methanol, 25% glacial acetic acid and 62.5% water, for 2 min. The smear was washed in running water, air dried and sealed with Permount (R), diluted 2:1 in xilol to avoid staining oxidation. Our results showed that refrigeration did not affect sperm capacitation and comparing staining methods, the PI/CFDA combination was more efficient to detect capacitated sperm, when compared to CB staining. In experiment 2, we evaluated the effect of different incubation time (1 - 5 h) with chondroitin sulfate and caffeine on sperm capacitation. For in vitro fertilization, oocytes were obtained from slaughterhouse ovaries. Oocytes with a thick and intact cumulus oophurus layer and cytoplasm with homogenous granules were selected for in vitro maturation for 44 h. According to the results of experiment 2, it was used for in vitro fertilization refrigerated semen was capacitated with 50 mu g/mL chondroitin sulfate for 2 h or capacitated with 5 mu g/mL caffeine for 3 h. Six hours after insemination, cumulus oophorus cells were mechanically removed and oocytes were washed and incubated in microdrops of culture medium. Embryo development after fertilization with sperm capacitated with caffeine or chondroitin sulfate was evaluated on days 3, 5 and 7 of culture. No differences were observed in days 3 or 5 of in vitro culture. However, it was observed an increase on blastocyst rate on Day 7 of culture when caffeine was used as the capacitor agent. Discussion: Molecular basis of sperm capacitation is still poor understood. Sperm capacitation can occur in vitro spontaneously in defined media without addition of biological fluids. We observed that sperm capacitation increased as incubation period enlarged and it was observed using Coomassie blue G and PI/CFDA for fresh semen and for refrigerated semen. It can be concluded that the cooling of semen did not change their pattern of sperm capacitation and this is best assessed by IP/CFDA than by CB. In addition to the use of caffeine in sperm capacitation produces more blastocysts than the chondroitin sulfate after in vitro fertilization.

Consequences for the Bovine Embryo of Being Derived from a Spermatozoon Subjected to Post-Ejaculatory Aging and Heat Shock: Development to the Blastocyst Stage and Sex Ratio

The objective was to determine whether aging of sperm caused by incubation at normothermic (38.5 C) or heat shock (40 C) temperatures for 4 h prior to oocyte insemination affects sperm motility, fertilizing ability, competence of the resultant embryo to develop to the blastocyst stage and blastocyst sex ratio. In the first experiment, the percent of sperm that were motile was reduced by aging (P<0.001) and the reduction in motility was greater for sperm at 40 C compared to sperm at 38.5 C (P<0.01). In the second experiment, oocytes were inseminated with aged sperm. A smaller percent of oocytes fertilized with sperm aged at either temperature cleaved by Day 3 after insemination than oocytes fertilized with fresh sperm (P<0.05). There was no effect of sperm aging on the percent of oocytes or cleaved embryos that developed to the blastocyst stage. Aging of sperm before fertilization at 38.5 C reduced the percent of blastocysts that were male (P=0.08). In the third experiment, incubation of sperm at 38.5 C or 40 C for 4 h did not reduce fertilizing ability of sperm as determined by pronuclear formation at 18 h post insemination. In conclusion, aging of sperm reduced cleavage rate and the percent of blastocysts that were males but had no effect on the developmental capacity of the. embryo. The effect of aging on cleavage rate may represent reduced motility and errors occurring after fertilization and pronuclear formation. Aging at a temperature characteristic of maternal hyperthermia had little additional effect except that polyspermy was reduced. Results indicate that embryo competence for development to the blastocyst stage is independent of sperm damage as a result of aging for 4 h at normothermic or hyperthermic temperatures.

Tick saliva inhibits the chemotactic function of MIP-1 alpha and selectively impairs chemotaxis of immature dendritic cells by down-regulating cell-surface CCR5

Ticks are blood-feeding arthropods that secrete immunomodulatory molecules through their saliva to antagonize host inflammatory and immune responses. As dendritic cells (DCs) play a major role in host immune responses, we studied the effects of Rhipicephalus sanguineus tick saliva on DC migration and function. Bone marrow-derived immature DCs pre-exposed to tick saliva showed reduced migration towards macrophage inflammatory protein (MIP)-1 alpha, MIP-1 beta and regulated upon activation, normal T cell expressed and secreted (RANTES) chemokines in a Boyden microchamber assay. This inhibition was mediated by saliva which significantly reduced the percentage and the average cell-surface expression of CC chemokine receptor CCR5. In contrast, saliva did not alter migration of DCs towards MIP-3 beta, not even if the cells were induced for maturation. Next, we evaluated the effect of tick saliva on the activity of chemokines related to DC migration and showed that tick saliva per se inhibits the chemotactic function of MIP-1 alpha, while it did not affect RANTES, MIP-1 beta and MIP-3 beta. These data suggest that saliva possibly reduces immature DC migration, while mature DC chemotaxis remains unaffected. In support of this, we have analyzed the percentage of DCs on mice 48 h after intradermal inoculation with saliva and found that the DC turnover in the skin was reduced compared with controls. Finally, to test the biological activity of the saliva-exposed DCs, we transferred DCs pre-cultured with saliva and loaded with the keyhole limpet haemocyanin (KLH) antigen to mice and measured their capacity to induce specific T cell cytokines. Data showed that saliva reduced the synthesis of both T helper (Th)1 and Th2 cytokines, suggesting the induction of a non-polarised T cell response. These findings propose that the inhibition of DCs migratory ability and function may be a relevant mechanism used by ticks to subvert the immune response of the host. (c) 2007 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Effect of follicular wave synchronization on in vitro embryo production in heifers

Aiming to achieve the ideal time of ovum pick-up (OPU) for in vitro embryo production (IVP) in crossbred heifers, two Latin square design studies investigated the effect of ovarian follicular wave synchronization with estradiol benzoate (EB) and progestins. For each experiment, crossbred heifers stage of estrous cycle was synchronized either with a norgestomet ear implant (Experiment 1) or a progesterone intravaginal device (Experiment 2) for 7d, followed by the administration of 150 mu g D-cloprostenol. On Day 7, all follicles >3 mm in diameter were aspirated and implants/devices were replaced by new ones. Afterwards, implant/device replacement was conducted every 14 d. Each experiment had three treatment groups. In Experiment I (n = 12), heifers in Group 2X had their follicles aspirated twice a week and those in Groups 1X and 1X-EB were submitted to OPU once a week for a period of 28 d. Heifers from Group 1X-EB also received 2 mg EB i.m. immediately after each OPU session. In Experiment 2 (n = 11), animals from Group 0EB did not receive EB while heifers in Groups 2EB and 5EB received 2 and 5 mg of EB respectively, immediately after OPU. The OPU sessions were performed once weekly for 28 d. Therefore, in both experiments, four OPU sessions were performed in heifers aspirated once a week and in Experiment 1, eight OPU sessions were done in heifers aspirated twice a week. Additionally, during the 7-d period following follicular aspiration, ovarian ultrasonography examinations were conducted to measure diameter of the largest follicle and blood samples were collected for FSH quantification by RIA. In Experiment 1, all viable oocytes recovered were in vitro matured and fertilized. Results indicated that while progestin and EB altered follicular wave patterns, this treatment did not prevent establishment of follicular dominance on the ovaries of heifers during OPU at 7-d intervals. Furthermore, the proposed stage of follicular wave synchronization strategies did not improve the number and quality of the recovered oocytes, or the number of in vitro produced embryos. (C) 2009 Elsevier B.V. All rights reserved.