Histopathological Alterations In The Prostates Of Mongolian Gerbils Exposed To A High-fat Diet And Di-n-butyl Phthalate Individually Or In Combination.

Both high-fat diet and exposure to endocrine-disrupting chemicals have been implicated in susceptibility to pathological prostate lesions, but the consequences of combining the two have not yet been examined. We evaluated the effects of gestational and postnatal exposure to a high-fat diet (20% fat) and low doses of di-n-butyl phthalate (DBP; 5mg/kg/day), individually or in combination, on the tissue response and incidence of pathological lesions in the ventral prostate of adult gerbils. Continuous intake of a high-fat diet caused dyslipidemia, hypertrophy, and promoted the development of inflammatory, premalignant and malignant prostate lesions, even in the absence of obesity. Life-time DBP exposure was obesogenic and dyslipidemic and increased the incidence of premalignant prostate lesions. Combined exposure to DBP and a high-fat diet also caused prostate hypertrophy, but the effects were less severe than those of individual treatments; combined exposure neither induced an inflammatory response nor altered serum lipid content.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Histopathological evaluation of root canal filling materials for primary teeth

This study aimed to assess the response of apical and periapical tissues of dogs' teeth after root canal filling with different materials. Forty roots from dogs' premolars were prepared biomechanically and assigned to 4 groups filled with: Group I: commercial calcium hydroxide and polyethylene glycol-based paste (Calen®) thickened with zinc oxide; Group II: paste composed of iodoform, Rifocort® and camphorated paramonochlorophenol; Group III: zinc oxide-eugenol cement; Group IV: sterile saline. After 30 days, the samples were subjected to histological processing. The histopathological findings revealed that in Groups I and IV the apical and periapical regions exhibited normal appearance, with large number of fibers and cells and no resorption of mineralized tissues. In Group II, mild inflammatory infiltrate and mild edema were observed, with discrete fibrogenesis and bone resorption. Group III showed altered periapical region and thickened periodontal ligament with presence of inflammatory cells and edema. It may be concluded that the Calen paste thickened with zinc oxide yielded the best tissue response, being the most indicated material for root canal filling of primary teeth with pulp vitality.

Histopathological evaluation of different methods of experimental induction of periapical periodontitis

This study evaluated histopathologically different methods of experimental induction of periapical periodontitis. The radiographic and microbiological evaluations have been performed in a previous investigation. Fifty-seven root canals from dogs' teeth were assigned to 4 groups. In GI (n=14) and GII (n=14), the root canals were exposed to oral environment for 180 days; in GIII (n=14) and GIV (n=15) the root canals were exposed for 7 days and then the access cavities were restored and remained sealed for 53 days. The root apices of GI and GIII were perforated, whilst those of GII and GIV remained intact. After induction of periapical periodontitis, the dogs were euthanized. Serial sections were obtained and stained with hematoxylin and eosin. Data of the histopathological evaluation were submitted to Kruskal-Wallis and Dunn's tests at 5% significance level. The inflammatory periapical reaction and resorption of mineralized tissues were less intense in GII than in the other groups (p<0.05). There was no histopathological difference among the experimentally induced periapical lesions in the teeth with coronal sealing. On the other hand, when coronal sealing was not performed, greater intensity of induced periapical periodontitis was observed in the teeth with apical perforation.

Histopathological, immunohistochemical and ultraestructural evaluation of inflammatory response in Arius genus fish under experimental inoculation of BCG

The aim of this study was to evaluate the inflammatory response kinetics after experimental inoculation with BCG in the primitive Arius sp. fish. The BCG was applied through the intramuscular injection in the caudal peduncular region, and the samples were collected for the analyses at days 1, 3, 7, 14, 21, and 33 post-injection. Acute phase inflammatory infiltrate was characterized by the predominant mononuclear cells, intersticial edema, and muscular tissue necrosis. As the inflammatory response evolved, a large number of multinuclear giant cells were formed containing the BCG. These giant cells were positive for the S100 protein at the histochemical analysis, which demonstrate the macrofage activity, confirmed by the ultra-structural analysis showing the lack of the cytoplasmic membrane enveloping the many nuclei within the giant cell. These results led to the conclusion that Arius sp. fish injected with the BCG showed a difuse inflammatory response characterized by a large number of mononuclear cells, absence of granuloma formation, and predominant giant cells.

Microbiological and histopathological aspects of canine pyometra

As pyometra is recognized as one of the main causes of disease and death in the bitch the purposes of this study were to evaluate microbiological and histopathological aspects of canine pyometra and to research the virulence factors of the E. coli isolates identifying possible risks to human health. The microbiological isolation from the intrauterine contents of 100 dogs with pyometra was carried out and the virulence factors in the E. coli strains were identified using PCR method. This study also consisted of the counting of microorganisms colonies forming units in samples of intrauterine content, tests of antimicrobial susceptibility of the E. coli isolates and the histological examination of the uterus. E. coli was the most prevalent microorganism isolated (76.6%) and 120 strains (79.5%) were positive for sfa, 86 (56.9%) were positive for cnf, 87 (57.6%) were positive for pap, 52 (34.4%) were positive for hly, 51 (33.8%) were positive for iuc and 5 (3.3%) were positive for afa genes. One observed more sensitivity of E. coli to norfloxacin, polimixin B, sulphazotrin, chloranfenicol and enrofloxacin. In 42% of the samples of uterine walls where microorganisms were isolated, the sizes of the areas of the inflammatory responses corresponded to 39-56%. Virulence factors were identified in 98.0% of the strains evaluated, demonstrating a high frequency of potentially pathogenic E. coli. It must be considered that dogs are animals that are living in close proximity to man for thousands of years and have an important role in the transmission of E. coli to other animals and to man.

Histopathological Changes in the Placentas and Fetuses of Mice Infected with Trypanosoma cruzi Isolated from the Myotis nigricans nigricans Bat

Histopathological changes and placental transmission were studied in the late stages of pregnancy in mice infected with a strain of Trypanosoma cruzi, isolated from a Myolis nigricans nigricans bat. Large amastigote nests were observed in uterine muscles, as well as in decidual and endothelial placental cells. In addition, persistent coagulative and fibrotic Vascular degeneration was observed. Large amastigote burdens were found in giant cells, spongioblasts and endothelial cells within the labyrinthine layer. Transplacental transmission was confirmed in 30% of the fetuses examined, in which amastrigote nests were seen only in striated muscle. During tire acute phase, intrauterine development was impaired as the result of parasitic invasion of the placenta, and fetal mortality rose to 10%. (C) 2008 Elsevier Ltd. All rights reserved.

Clinical, dermoscopic and histopathological evaluation of the Meyerson nevus - Case report

Meyerson nevi occur whenever a rare focal and transitory eczematous eruption arises around melanocytic lesions. The same phenomenon has also been observed in non-melanocytic lesions as well. Herein we report the case of a 25 year old, male patient, who had noticed, two months before, the arising of a pruriginous and erithematous halo around two nevi localized on his abdomen. The lesions were found to be atypical on dermoscopic examination and he was submitted to surgical excision of both nevi. Histopathological examination revealed displastic compound melanocytic nevi, surrounded by intraepidermical vesicles and spongiosis. Present report suggests that Meyerson phenomenon does not seem to alter dermoscopic features of nevi.

Histopathological changes induced by extracts from the tissue covering the stingers of Potamotrygon falkneri freshwater stingrays

Pain is the most conspicuous symptom observed in patients wounded by stingrays, and skin necrosis is common in accidents by freshwater stingrays. The extract from the stinger integumentary tissue of Potamotrygon falkneri containing toxic components (venom) was tested for its ability to induce histopathological changes in the dorsal skin of mice at different times. 3-6 h after injection, foci of necrosis in isolated basal epidermal cells were observed. Full coagulative necrosis of the skin, subcutaneous tissue and skeletal muscle was evident as soon as 24 h after venom exposure, with a clear demarcation from the normal skin. After 48 h, round collections of necrotic cells start to coalesce originating extensive skin necrotic plaques that detach from viable tissue after 72-96 h. Inflammatory infiltrate was observed after 6 h, but was always mild. Acute vascular thrombosis was rare, and hemorrhage was not present at any time. Superficial bacterial infection was present in two of the examined cases. In conclusion, the venom of P. falkneri is responsible for the development of an early necrosis with mild inflammatory reaction, probably due to direct action of the venom. The severe local damage is probably worsened by the mechanical trauma caused by the stinger. (c) 2010 Elsevier Ltd. All rights reserved.

Liver HLA-G expression is associated with multiple clinical and histopathological forms of chronic hepatitis B virus infection

As the mechanisms leading to the persistence of hepatitis B virus (HBV) infection are poorly understood and as the histocompatibility leucocyte antigen (HLA)-G is well described as a tolerogenic molecule, we evaluated HLA-G expression in 74 specimens of HBV liver biopsies and in 10 specimens obtained from previously healthy cadaver liver donors. HBV specimens were reviewed and classified by the METAVIR score, and HLA-G expression was assessed by immunohistochemistry. No HLA-G expression was observed in control hepatocytes. In contrast, 57 (77%) of 74 HBV specimens showed soluble and membrane-bound HLA-G expression in hepatocytes, biliary epithelial cells or both. No associations between the intensity of HLA-G expression and patient age or gender, HBeAg status, severity of liver fibrosis, and grade of histological findings were observed. Although significance was not reached (P = 0.180), patients exhibiting HLA-G expression presented a higher median HBV DNA viral load (105 copies/mL) than those who did not express HLA-G (103.7 copies/mL). These results indicate that HLA-G is expressed in most cases of chronic HBV infection in all stages and may play a role in the persistency of HBV infection.

Progression of Lipid Peroxidation Measured as Thiobarbituric Acid Reactive Substances, Damage to DNA and Histopathological Changes in the Liver of Rats Subjected to a Methionine-Choline-Deficient Diet

Methionine-choline-deficient diet represents a model for the study of the pathogenesis of steatohepatitis. Male rats were divided into three groups, the first group receiving a control diet and the other two groups receiving a methionine-choline-deficient diet for 1 month (MCD1) and for 2 months (MCD2), respectively. The livers of the animals were collected for the determination of vitamin E, thiobarbituric acid reactive substances (TBARS), GSH concentration, DNA damages, and for histopathological evaluation. The hepatic TBARS and GSH content was higher (P < 0.05) in the groups receiving the experimental diet (MCD1 and MCD2) compared to control diet, and hepatic vitamin E concentration differed (P < 0.05) between the MCD1 and MCD2 groups, with the MCD2 group presenting a lower concentration. Damage to hepatocyte DNA was greater (P < 0.05) in the MCD2 group (262.80 DNA injuries/100 hepatocytes) compared to MCD1 (136.4 DNA injuries/100 hepatocytes) and control diet (115.83 DNA injuries/100 hepatocytes). Liver histopathological evaluation showed that steatosis, present in experimental groups was micro- and macro-vesicular and concentrated around the centrolobular vein, zone 3, with preservation of the portal space. The inflammatory infiltrate was predominantly periductal and the steatosis and inflammatory infiltrate was similar in the MCD1 and MCD2 groups, although the presence of Mallory bodies was greater in the MCD2 group. The study describes the contribution of a methionine-choline-deficient diet to the progression of steatosis, lipid peroxidation and hepatic DNA damage in rats, serving as a point of reflection about the role of these nutrients in the western diet and the elevated non-alcoholic steatohepatitis rates in humans.

SAPHO syndrome with temporomandibular joint ankylosis: clinical, radiological, histopathological, and therapeutical correlations

The SAPHO syndrome is characterized by specific clinical manifestations of synovitis, acne pustulosis, hyperostosis, and osteitis. It is a rare disease with a combination of osseous and articular manifestations associated with skin lesions. We describe a patient with SAPHO syndrome of the mandible and involvement of the temporomandibular joint (TMJ ankylosis). The findings from orthopantomography, computed tomography (CT), and clinical and histopathological examinations are compared and analyzed to improve the final diagnosis. Our patient was submitted to a bilateral high condylectomy and coronoidectomy to correct the open mouth limitation. No previous report of SAPHO syndrome associated with secondary TMJ ankylosis was found in the literature.

Oral squamous cell carcinoma: status of tight junction claudins in the different histopathological patterns and relationship with clinical parameters. A tissue-microarray-based study of 136 cases

Aims Claudins are integral transmembrane proteins of the tight junctions, critical for maintaining cell adhesion and polarity. Alterations in the expression of individual claudins have been detected in carcinomas and appear to correlate with tumour progression. Methods In this study, a panel of anti-claudin antibodies (anti-claudins 1, 2, 3, 4, 5 and 7) was employed to map claudin expression in 136 cases of oral squamous cell carcinoma (OSCC) organised in a tissue microarray. Results Claudins were expressed in a reticular pattern up to the prickle layer in normal mucosal epithelium. In OSCC, claudins were strongly present in well-differentiated tumours, they presented mild and low expression in moderately differentiated OSCC, and were negative in poorly differentiated OSCC; the absences of claudin 1 (p = 0.002) and claudin 4 (p<0.001) were associated with moderately/poorly differentiated tumours. Strong expression of claudin 4 was associated with decreased perineural infiltration (p = 0.024). Claudins 5 and 7 were mostly negative or weakly expressed in all cases studied. Expression of claudin 7 was associated with the early clinical stages of the disease, whereas loss of claudin 7 tended to be more frequent in advanced stages of OSCC (p = 0.054). Absence of claudin 7 was also associated with absent vascular infiltration (p = 0.045) and with presence of recurrence (p = 0.052). Conclusions Claudin expression patterns showed a strong correlation with histological type of OSCC; claudin expression was decreased in areas of invasion, and negative in poorly differentiated tumours. This pattern may be related to evolution and prognosis of these tumours, especially in the case of claudin 7, which seems to be associated with a poor prognosis in OSCC.

Phyllodes tumors of the breast: Correlation of nucleolar organizer regions with histopathological malignancy grading, flow cytometric DNA analysis and clinical outcome

To examine whether nucleolar organizer regions detected by argyrophilia (Ag-NOR counts) can be used as a prognostic indicator in phyllodes tumors of the breast, and to compare its usefulness with that of DNA flow cytometric analysis, 28 cases of breast phyllodes tumors (including 15 benign, two borderline and 11 malignant tumors) were subjected to Ag-NOR staining and counting as well as DNA flow cytometric analysis. S-phase fraction and DNA ploidy analysis showed useful trends for improving outcome predictions in malignant phyllodes tumors. However, high Ag-NOR counts were significant in predicting survival status (P = 0.013) and reached near statistical significance in predicting survival times (P = 0.07). In predicting survival status, results for Ag-NOR counts were significantly better than those for ploidy analysis (P = 0.02) and S-phase fraction (P < 0.01). Only S-phase fraction was significantly predictive of survival times (P = 0.025). It is concluded that Ag-NOR counts and DNA flow cytometric analysis, easily performed using paraffin sections, give information that can improve predictions made by histopathological classification. Ag-NOR counts are significant in predicting survival in the presence of histopathological features of malignancy.