896 resultados para fruit beverage
Resumo:
Ready-to-drink fruit juices represent a large share of the market and are an important target for product development. The mixture of fruits can bring about improvements to nutritional and sensory aspects of these beverages while making used of the wide variety of exotic fruits from the Amazon region. Therefore, it is necessary to select mixed fruits and determine their ideal sweetness according to consumer acceptance. Consumers in the city of Belém (Brazil) evaluated five different concentrations of sugar using the just-about-right scale in two blends selected by preference ranking. For the cupuassu-acerola-açai blend, the optimum concentration of sugar was 9.5 g/100 mL, and for the soursop-camucamu-yellow mombin blend, it was 10.7 g/100 mL.
Resumo:
The objective of this study was to develop pitanga nectar formulations in which sucrose was replaced with different sweeteners. Consumer tests were conducted with 50 fruit juice consumers, and a just-about-right scale was used to determine the ideal pulp dilution and ideal sweetness with sucrose. Furthermore, the adequate concentrations of six sweeteners were determined to obtain the equivalent sweetness of sucrose using relative to these concentrations the magnitude estimation model with 19 selected assessors. The ideal dilution test resulted in 25% pulp, and the ideal sweetness test, 10% sucrose. Sweetener concentrations to replace sucrose were 0.0160%, 0.0541%, 0.1000%, 0.0999%, 0.0017%, and 0.0360%, respectively, for sucralose, aspartame, stevia 40% rebaudioside A, stevia 95% rebaudioside A, neotame, and a 2:1 cyclamate/saccharin blend. These results can be used to prepare pitanga nectar with different sweeteners and obtain the same sweetness intensity in less caloric products than that of nectar prepared with sucrose.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
The aim of this work was to develop an isotopic analysis method to quantify the carbon of C3 photosynthesis cycle in grape nectar and to identify the commercial beverages in disagreement to the Brazilian Ministry of Agriculture, Livestock and Food Supply (MAPA) regulation. The nectars were produced in a laboratory, according to the Brazilian Law. Adulterated beverages with quantity of grape juice lower than the legal limit were also produced. Isotopic analysis measured the relative isotopic enrichment of grape nectar and its purified sugar fraction. Based on these results, it was possible to estimated the quantity of source C3 by means of isotopic dilution equation. To determine the existence of adulteration in commercial nectars, it was necessary to create a legal limit according to the Brazilian Law. One of the twelve commercial brands of nectar analyzed was classified as adulterated. The developed methodology proved to be efficient to quantify the carbon of C3 origin and identify the adulterated commercial grape nectar.
Resumo:
Pós-graduação em Agronomia (Energia na Agricultura) - FCA
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
Nowadays, new emerging products claiming antioxidant properties are becoming more frequent. However, information about this topic in their labels is usually scarce. In this paper, we analyzed total phenolics, total flavonoids and ascorbic acid contents, as well as DPPH scavenging activity of several commercial samples, namely green tea and other herbal infusions, dietary supplements, and fruit juices, available in the Portuguese market. In general, beverages containing green tea and hibiscus showed higher phenolics contents (including flavonoids) and antioxidant activity than those without these ingredients. A borututu infusion presented the lowest concentrations of bioactive compounds and scavenging activity, due to the low recommended amount of plant to prepare the beverage. Some juices without antioxidant claims in the label presented similar values to those with it.
Influence of natural fruit juices in removing the smear layer from root surfaces - An in vitro study
Resumo:
Certain elements of a patient's diet may be associated with dentin hypersensitivity. The intent of this study was to evaluate the degree of removal of the smear layer from dentin surfaces by various fruit juices. A smear layer was created on extracted human teeth by manual scaling. The roots were reduced and distributed into 8 experimental groups. Distilled water was the negative control. The juices were applied by 2 methods: topical application and topical application with friction. Specimens were photomicrographed and graded according to an index of smear layer removal. With topical application, all but 2 of the tested substances resulted in significantly greater removal of the smear layer and opening of dentinal tubules than was the case with the negative control (p = 0.05); the exceptions were Gala apple and Italian grape juices, which were no different from the control. For the active application (with friction), most substances removed more smear layer than the control (p < 0.05); Gala apple, Italian grape and orange juices were similar to the control. For each of the tested substances, removal of the smear layer did not differ with the method of application (topical vs. friction; p > 0.05). It is concluded that natural fruit juices can remove the smear layer from dentin surfaces, and the efficacy of this removal varies with the type of juice. © J Can Dent Assoc 2004.
Resumo:
Habitual consumption of sugar-sweetened beverages (SSB) has been reliably linked to obesity in adolescents. A wide variety of beverages sweetened with sugar are available to this population. The objective of this secondary data analysis was to assess the consumption of SSB by category and to identify behaviors that occur concurrently with the consumption of soda, sport drinks and fruit-flavored drinks in high school students. The analysis used self-reported survey data from 97 adolescents ages 14 to 18. SSB categories considered in the consumption analysis included regular soda, sports drinks, fruit-flavored drinks (FFD), iced tea, coffee drinks and energy drinks. The mean weekly sweetened beverage load in this population, calculated from the frequency and amount of consumption, was 145 ounces when all categories were considered. When SSB categories were considered independently, sports drinks (45 oz.) had the highest contribution to the mean sweetened beverage load followed by FFD (41 oz.), iced tea (27 oz.), soda (26 oz.) coffee drinks (15 oz.) and energy drinks (2 oz.). Sweetened beverage load was higher in boys (151 oz.) than girls (138 oz.) and was highest in Hispanics (159 oz.) followed by whites (152 oz.), blacks (137 oz.) and others (104 oz.). Behaviors that occurred on a usual basis during SSB consumption included watching TV, eating a family meal, eating salty and fried foods, being on the computer and hanging out with friends. Activities concurrent with sports drink consumption included physical activity behaviors whereas soda and FFD did not. Sports drink and FFD consumption commonly co-occurred with fruit consumption. Multiple SSB categories contribute to the total SSB consumption and the common dietary and activity behaviors are distinct between categories. Several of the concurrent behaviors point to the importance of home beverage availability, and to the influence that parents and peers have on SSB consumption. Identifying and assessing intervention strategies targeted to specific beverage categories could be an important step in behavioral intervention research aimed at reducing added sugar consumption, and ultimately, promote a healthy weight in adolescents. ^
Resumo:
INTRODUCTION: The differential associations of beer, wine, and spirit consumption on cardiovascular risk found in observational studies may be confounded by diet. We described and compared dietary intake and diet quality according to alcoholic beverage preference in European elderly.
METHODS: From the Consortium on Health and Ageing: Network of Cohorts in Europe and the United States (CHANCES), seven European cohorts were included, i.e. four sub-cohorts from EPIC-Elderly, the SENECA Study, the Zutphen Elderly Study, and the Rotterdam Study. Harmonized data of 29,423 elderly participants from 14 European countries were analyzed. Baseline data on consumption of beer, wine, and spirits, and dietary intake were collected with questionnaires. Diet quality was assessed using the Healthy Diet Indicator (HDI). Intakes and scores across categories of alcoholic beverage preference (beer, wine, spirit, no preference, non-consumers) were adjusted for age, sex, socio-economic status, self-reported prevalent diseases, and lifestyle factors. Cohort-specific mean intakes and scores were calculated as well as weighted means combining all cohorts.
RESULTS: In 5 of 7 cohorts, persons with a wine preference formed the largest group. After multivariate adjustment, persons with a wine preference tended to have a higher HDI score and intake of healthy foods in most cohorts, but differences were small. The weighted estimates of all cohorts combined revealed that non-consumers had the highest fruit and vegetable intake, followed by wine consumers. Non-consumers and persons with no specific preference had a higher HDI score, spirit consumers the lowest. However, overall diet quality as measured by HDI did not differ greatly across alcoholic beverage preference categories.
DISCUSSION: This study using harmonized data from ~30,000 elderly from 14 European countries showed that, after multivariate adjustment, dietary habits and diet quality did not differ greatly according to alcoholic beverage preference.
Resumo:
Guarana seeds have the highest caffeine concentration among plants accumulating purine alkaloids, but in contrast with coffee and tea, practically nothing is known about caffeine metabolism in this Amazonian plant. In this study, the levels of purine alkaloids in tissues of five guarana cultivars were determined. Theobromine was the main alkaloid that accumulated in leaves, stems, inflorescences and pericarps of fruit, while caffeine accumulated in the seeds and reached levels from 3.3% to 5.8%. In all tissues analysed, the alkaloid concentration, whether theobromine or caffeine, was higher in young/immature tissues, then decreasing with plant development/maturation. Caffeine synthase activity was highest in seeds of immature fruit. A nucleotide sequence (PcCS) was assembled with sequences retrieved from the EST database REALGENE using sequences of caffeine synthase from coffee and tea, whose expression was also highest in seeds from immature fruit. The PcCS has 1083bp and the protein sequence has greater similarity and identity with the caffeine synthase from cocoa (BTS1) and tea (TCS1). A recombinant PcCS allowed functional characterization of the enzyme as a bifunctional CS, able to catalyse the methylation of 7-methylxanthine to theobromine (3,7-dimethylxanthine), and theobromine to caffeine (1,3,7-trimethylxanthine), respectively. Among several substrates tested, PcCS showed higher affinity for theobromine, differing from all other caffeine synthases described so far, which have higher affinity for paraxanthine. When compared to previous knowledge on the protein structure of coffee caffeine synthase, the unique substrate affinity of PcCS is probably explained by the amino acid residues found in the active site of the predicted protein.
Resumo:
Passiflora species are distributed throughout Latin America, and Brazil and Colombia serve as the centers of diversity for this genus. We performed cross-species amplification to evaluate 109 microsatellite loci in 14 Passiflora species and estimated the diversity and genetic structure of Passiflora cincinnata, Passiflora setaceae and Passiflora edulis. A total of 127 accessions, including 85 accessions of P. edulis, a commercial species, and 42 accessions of 13 wild species, were examined. The cross-species amplification was effective for obtaining microsatellite loci (average cross-amplification of 70%). The average number of alleles per locus (five) was relatively low, and the average diversity ranged from 0.52 in P. cincinnata to 0.32 in P. setacea. The Bayesian analyses indicated that the P. cincinnata and P. setacea accessions were distributed into two groups, and the P. edulis accessions were distributed into five groups. Private alleles were identified, and suggestions for core collections are presented. Further collections are necessary, and the information generated may be useful for breeding and conservation.
Resumo:
In this work, all publicly-accessible published findings on Alicyclobacillus acidoterrestris heat resistance in fruit beverages as affected by temperature and pH were compiled. Then, study characteristics (protocols, fruit and variety, °Brix, pH, temperature, heating medium, culture medium, inactivation method, strains, etc.) were extracted from the primary studies, and some of them incorporated to a meta-analysis mixed-effects linear model based on the basic Bigelow equation describing the heat resistance parameters of this bacterium. The model estimated mean D* values (time needed for one log reduction at a temperature of 95 °C and a pH of 3.5) of Alicyclobacillus in beverages of different fruits, two different concentration types, with and without bacteriocins, and with and without clarification. The zT (temperature change needed to cause one log reduction in D-values) estimated by the meta-analysis model were compared to those ('observed' zT values) reported in the primary studies, and in all cases they were within the confidence intervals of the model. The model was capable of predicting the heat resistance parameters of Alicyclobacillus in fruit beverages beyond the types available in the meta-analytical data. It is expected that the compilation of the thermal resistance of Alicyclobacillus in fruit beverages, carried out in this study, will be of utility to food quality managers in the determination or validation of the lethality of their current heat treatment processes.
Resumo:
The family Malpighiaceae presents species with different habits, fruit types and cytological characters. Climbers are considered the most derived habit, followed, respectively, by the shrubby and arboreal ones. The present study examines the relationship between basic chromosome numbers and the derivation of climbing habit and fruit types in Malpighiaceae. A comparison of all the chromosome number reports for Malpighiaceae showed a predominance of chromosome numbers based on x=5 or 10 in the genera of sub-family Malpighioideae, mainly represented by climbers with winged fruits, whereas non-climbing species with non-winged fruits, which predominate in sub-family Byrsonimoideae, had counts based on x=6, which is considered the less derived basic number for the family. Based on such data, confirmed by statistic assays, and on the monophyletic origin of this family, we admit the hypothesis that morphological derivation of habit and fruit is correlated with chromosome basic number variation in the family Malpighiaceae.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.