One Step Forward: Contrasting The Effects Of Toe Clipping And Pit Tagging On Frog Survival And Recapture Probability.

Amphibians have been declining worldwide and the comprehension of the threats that they face could be improved by using mark-recapture models to estimate vital rates of natural populations. Recently, the consequences of marking amphibians have been under discussion and the effects of toe clipping on survival are debatable, although it is still the most common technique for individually identifying amphibians. The passive integrated transponder (PIT tag) is an alternative technique, but comparisons among marking techniques in free-ranging populations are still lacking. We compared these two marking techniques using mark-recapture models to estimate apparent survival and recapture probability of a neotropical population of the blacksmith tree frog, Hypsiboas faber. We tested the effects of marking technique and number of toe pads removed while controlling for sex. Survival was similar among groups, although slightly decreased from individuals with one toe pad removed, to individuals with two and three toe pads removed, and finally to PIT-tagged individuals. No sex differences were detected. Recapture probability slightly increased with the number of toe pads removed and was the lowest for PIT-tagged individuals. Sex was an important predictor for recapture probability, with males being nearly five times more likely to be recaptured. Potential negative effects of both techniques may include reduced locomotion and high stress levels. We recommend the use of covariates in models to better understand the effects of marking techniques on frogs. Accounting for the effect of the technique on the results should be considered, because most techniques may reduce survival. Based on our results, but also on logistical and cost issues associated with PIT tagging, we suggest the use of toe clipping with anurans like the blacksmith tree frog.

One step forward: contrasting the effects of Toe clipping and PIT tagging on frog survival and recapture probability

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Transient “deafness” accompanies auditory development during metamorphosis from tadpole to frog

During metamorphosis, ranid frogs shift from a purely aquatic to a partly terrestrial lifestyle. The central auditory system undergoes functional and neuroanatomical reorganization in parallel with the development of new sound conduction pathways adapted for the detection of airborne sounds. Neural responses to sounds can be recorded from the auditory midbrain of tadpoles shortly after hatching, with higher rates of synchronous neural activity and lower sharpness of tuning than observed in postmetamorphic animals. Shortly before the onset of metamorphic climax, there is a brief “deaf” period during which no auditory activity can be evoked from the midbrain, and a loss of connectivity is observed between medullary and midbrain auditory nuclei. During the final stages of metamorphic development, auditory function and neural connectivity are restored. The acoustic communication system of the adult frog emerges from these periods of anatomical and physiological plasticity during metamorphosis.

FM1-43 dye ultrastructural localization in and release from frog motor nerve terminals.

Previous work has shown that the fluorescent styryl dye FM1-43 stains nerve terminals in an activity-dependent fashion. This dye appears to label the membranes of recycled synaptic vesicles by being trapped during endocytosis. Stained terminals can subsequently be destained by repeating nerve stimulation in the absence of dye; the destaining evidently reflects escape of dye into the bathing medium from membranes of exocytosing synaptic vesicles. In the present study we tested two key aspects of this interpretation of FM1-43 behavior, namely: (i) that the dye is localized in synaptic vesicles, and (ii) that it is actually released into the bathing medium during destaining. To accomplish this, we first photolyzed the internalized dye in the presence of diaminobenzidine. This created an electron-dense reaction product that could be visualized in the electron microscope. Reaction product was confined to synaptic vesicles, as predicted. Second, using spectrofluorometry, we quantified the release of dye liberated into the medium from tubocurarine-treated nerve-muscle preparations. Nerve stimulation increased the amount of FM1-43 released, and we estimate that normally a stained synaptic vesicle contains a few hundred molecules of the dye. The key to the successful detection of released FM1-43 was to add the micelle-forming detergent 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS), which increased FM1-43 quantum yield by more than two orders of magnitude.

On Advertisement Call Of The Poison Frog Ameerega Berohoka (dendrobatidae, Anura) From The Brazilian Cerrado.

The poison frog genus Ameerega (Dendrobatidae) currently contains 32 species. They are distributed from central Brazil into western Amazonia to the lower Andean versant. In addition, three trans-Andean species have been allocated to Ameerega (Andrade et al. 2013; Frost 2014). Ameerega berohoka (Vaz-Silva & Maciel 2011) was described based on specimens from central Brazil (type-locality: Arenópolis, GO) and it is assumed to occur in parts of western and southwestern state of Goiás (Frost 2014). More recently, Andrade et al. (2013) extended its distribution to the state of Mato Grosso. Here we re-describe the advertisement call of A. berohoka, providing additional information regarding its temporal structure and spectral traits. Our observations also consist of a new distribution record for this species to the state of Mato Grosso.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.