Application of real-time fluorescent PCR for quantitative assessment of Neospora caninum infections in organotypic slice cultures of rat central nervous system tissue

The previously described Nc5-specific PCR test for the diagnosis of Neospora caninum infections was used to develop a quantitative PCR assay which allows the determination of infection intensities within different experimental and diagnostic sample groups. The quantitative PCR was performed by using a dual fluorescent hybridization probe system and the LightCycler Instrument for online detection of amplified DNA. This assay was successfully applied for demonstrating the parasite proliferation kinetics in organotypic slice cultures of rat brain which were infected in vitro with N. caninum tachyzoites. This PCR-based method of parasite quantitation with organotypic brain tissue samples can be regarded as a novel ex vivo approach for exploring different aspects of cerebral N. caninum infection.

PCR fluorescente associada à eletroforese capilar como ferramenta de diagnóstico de bactérias no semen

This study was performed in order to evaluate the detection limit of PCR with fluorescent capillary electrophoresis for Brucella abortus diagnosis in bovine semen. Negative bovine semen samples were artificially contaminated with B. abortus (10(0) to 10(7) bacteria/mL) and DNA was extracted by phenol/chloroform protocol. DNA was amplified by PCR with oligonucleotides previously described BF-5'gcgctcaggctgccgacgcaa3' (6-FAM labeled) and BR-5'accagccattgcggtcggta3' for B. abortus. Oligonucleotides generated DNA fragments of 193 bp. DNA fragments visualization was done under UV light at silver stained 8% poliacrylamide gel, and fluorescent capillary electrophoresis performed in an automatic DNA fragment analyzer. The detection limit of capillary electrophoresis for B. abortus was 10³ bacteria/mL, while for silver stained 8% poliacrylamide gel it was 10(5) bacteria/mL. PCR with fluorescent capillary electrophoresis is fast, efficient and highly sensitive test for DNA detection of Brucella in bovine semen, and itcan be an important tool for health evaluation of the herd and semen sanitary control in artificial insemination centers.

Prenatal diagnosis of tetrasomy 18p using multiplex fluorescent PCR and comparison with a variety of techniques

We report genetic characterization of isochromosome 18p using a combination of cytogenetic and molecular genetic methods, including multiplex fluorescent PCR. The patient was referred for chorionic villus sampling (CVS) due to advanced maternal age and maternal anxiety. The placental karyotype was 47,XX,+mar, with the marker having the appearance of a small supernumerary isochromosome. Because differentiating between isochromosomes and other structural rearrangements is normally very difficult, a variety of genetic tests including fluorescence in situ hybridization (FISH), PCR, and multiplex fluorescent PCR were undertaken to determine chromosomal origin and copy number and, thus, allow accurate diagnosis of the corresponding syndrome. FISH determined that the marker chromosome contained chromosome 18 material. PCR of a variety of short tandem repeats (STRs) confirmed that there was at least one extra copy of the maternal 18p material. However, neither FISH nor PCR could accurately determine copy number. Multiplex fluorescent PCR (MF-PCR) of STRs simultaneously determined that: (1) the marker included 18p material; (2) the marker was maternal in origin; (3) allele copy number indicated tetrasomy; and (4) contamination of the sample could be ruled out. Results were also rapid with accurate diagnosis of the syndrome tetrasomy 18p possible within 5 hours.

Epstein-Barr Virus (EBV) detection and typing by PCR: a contribution to diagnostic screening of EBV-positive Burkitt's lymphoma

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Facteurs de risque d´introduction et diagnostic de Mycobacterium avium ssp. paratuberculosis

Mycobacterium avium ssp. paratuberculosis (MAP) est l'agent causal de la paratuberculose, maladie entérique, chronique et incurable des ruminants, avec un impact économique important. Une meilleure compréhension des facteurs de risque associés à l'introduction de la maladie dans un troupeau est essentielle pour sa prévention. L’amélioration des tests diagnostiques est aussi importante pour son contrôle. L’introduction des nouveaux animaux dans le troupeau et la présence et contact des différentes espèces sauvages et domestiques avec les vaches, semblent être des facteurs de risques d’introduction de la maladie. Nous avons réalisé une revue systématique dont l`objective était de recueillir l’information pertinente pour répondre à la question sur l’importance de ces facteurs et leur impact sur l’introduction de la maladie dans un troupeau. D`un autre côté, la détection de MAP dans les fèces par culture bactérienne demeure la méthode diagnostique de choix malgré les facteurs qui l`affectent. Une série de 3 étapes est requise afin de confirmer la présence du MAP : (1) culture (2) coloration, et (3) confirmation du MAP par PCR (si détecté à l´étape 2). Certains échantillons fécaux présentent une particularité en raison de leur forte charge de micro-organismes. Ces contaminants peuvent interférer avec la croissance et la détection de MAP. Une étude visant à : a) estimer l'impact des certain covariables sur les résultats de la culture de MAP parmi l`analyse rétrospective d`un banque des données et b) évaluer la possibilité d'optimiser le processus de diagnostic du MAP en effectuant l'analyse PCR sur les cultures déclarées comme contaminées a été réalisée.

PCR Multiplex fluorescente para detecção de bactérias em sêmen bovino

Este estudo teve como objetivo avaliar o limiar de detecção da técnica de PCR multiplex fluorescente aliada a eletroforese capilar na detecção de agentes infecciosos em amostras de sêmen experimentalmente contaminadas com concentrações decrescentes das bactérias Brucella abortus, Leptospira interrogans sorovar pomona, Campylobacter fetus e Haemophilus somnus. Amostras de sêmen bovino foram experimentalmente contaminadas com concentrações decrescentes de bactérias obtidas através de diluições seriadas na base 10 de modo a obter-se amostras contendo desde 1 vez até 10-7 bactérias/mL a partir da concentração inicial de Leptospira pomona, Brucella abortus, Campylobacter fetus e Haemophilus somnus. As diluições foram efetuadas individualmente para cada bactéria, bem como nas diferentes concentrações necessárias para a padronização do teste de multiplex PCR. As extrações de DNA de todas as soluções contendo espermatozóides e bactérias analisadas no presente estudo foram realizadas segundo protocolo descrito por Heinemann et al. (2000). Os produtos de PCR multiplex foram avaliados por eletroforese em gel de poliacrilamida 8% e separação eletroforética por sistema capilar em equipamento automático de análise de fragmentos de DNA MegaBace. Observou-se a amplificação de fragmentos de 193pb, 330pb, 400pb e 415pb a partir do DNA de B. abortus, L. pomona, H. somnus, C. fetus, respectivamente. Na análise por eletroforese capilar de produtos da PCR multiplex do DNA para detecção simultânea dos quatro patógenos observou-se a sinal de positividade até a diluição de 10-3 bactérias/mL vezes da concentração inicial da solução estoque de cada bactéria. A técnica de PCR multiplex aliada à eletroforese capilar foi usada pela primeira vez para o diagnóstico direto de quatro bactérias patogênicas no sêmen, demonstrando ser um método rápido na detecção de bactérias causadoras de doenças reprodutivas.

APPLICABILITY OF kDNA-PCR FOR ROUTINE DIAGNOSIS OF AMERICAN TEGUMENTARY LEISHMANIASIS IN A TERTIARY REFERENCE HOSPITAL.

This study evaluated the applicability of kDNA-PCR as a prospective routine diagnosis method for American tegumentary leishmaniasis (ATL) in patients from the Instituto de Infectologia Emílio Ribas (IIER), a reference center for infectious diseases in São Paulo - SP, Brazil. The kDNA-PCR method detected Leishmania DNA in 87.5% (112/128) of the clinically suspected ATL patients, while the traditional methods demonstrated the following percentages of positivity: 62.8% (49/78) for the Montenegro skin test, 61.8% (47/76) for direct investigation, and 19.3% (22/114) for in vitro culture. The molecular method was able to confirm the disease in samples considered negative or inconclusive by traditional laboratory methods, contributing to the final clinical diagnosis and therapy of ATL in this hospital. Thus, we strongly recommend the inclusion of kDNA-PCR amplification as an alternative diagnostic method for ATL, suggesting a new algorithm routine to be followed to help the diagnosis and treatment of ATL in IIER.

Quantitative PCR for the diagnosis of cutaneous leishmaniasis from formalin-fixed and paraffin-embedded skin sections.

The present report describes a real-time PCR-based procedure to reliably determine the quantity of Leishmania amastigotes in relation to the amount of host tissue in histological skin sections from canine and equine cases of cutaneous leishmaniasis. The novel diagnostic Leishmania-PCR has a detection limit of <0.02 amastigotes per μg tissue, which corresponds well to the detection limit of immunohistochemistry and is far beyond that of conventional histology. Our results emphasise the importance of PCR to complement routine histology of cutaneous leishmaniasis cases, particularly in laboratories in which no immunohistochemical assay is available.

Diagnóstico de mastite subclínica caprina por meio da detecção de Staphylococcus aureus utilizando a técnica de RT-PCR.

A presente publicação descreve os procedimentos necessários para a identificação e confirmação molecular de estirpes de S. aureus causadoras de mastite subclínica, provenientes de amostras de leite de cabra, por meio da técnica de RT-PCR.

Identification of a mutation in the para-sodium channel gene of the cattle tick Rhipicephalus (Boophilus) microplus associated with resistance to synthetic pyrethroid acaricides

Resistance against synthetic pyrethroid (SP) products for the control of cattle ticks in Australia was detected in the field in 1984, within a very short time of commercial introduction. We have identified a mutation in the domain II S4-5 linker of the para-sodium channel that is associated with resistance to SPs in the cattle tick Rhipicephalus (Boophilus) microplus from Australia. The cytosine to adenine mutation at position 190 in the R. microplus sequence AF134216, results in an amino acid substitution from leucine in the susceptible strain to isoleucine in the resistant strain. A similar mutation has been shown to confer SP resistance in the whitefly, Bemisia tabaci, but has not been described previously in ticks. A diagnostic quantitative PCR assay has been developed using allele-specific Taqman® minor groove-binding (MGB) probes. Using the assay to screen field and laboratory populations of ticks showed that homozygote allelic frequencies correlated highly with the survival percentage at the discriminating concentration of cypermethrin.

Community-acquired pneumonia in Chile: the clinical relevance in the detection of viruses and atypical bacteria

Background Adult community-acquired pneumonia (CAP) is a relevant worldwide cause of morbidity and mortality, however the aetiology often remains uncertain and the therapy is empirical. We applied conventional and molecular diagnostics to identify viruses and atypical bacteria associated with CAP in Chile. Methods We used sputum and blood cultures, IgG/IgM serology and molecular diagnostic techniques (PCR, reverse transcriptase PCR) for detection of classical and atypical bacteria (Mycoplasma pneumoniae, Chlamydia pneumoniae, Legionella pneumoniae) and respiratory viruses (adenovirus, respiratory syncytial virus (RSV), human metapneumovirus, influenza virus, parainfluenzavirus, rhinovirus, coronavirus) in adults >18 years old presenting with CAP in Santiago from February 2005 to September 2007. Severity was qualified at admission by Fine's pneumonia severity index. Results Overall detection in 356 enrolled adults were 92 (26%) cases of a single bacterial pathogen, 80 (22%) cases of a single viral pathogen, 60 (17%) cases with mixed bacterial and viral infection and 124 (35%) cases with no identified pathogen. Streptococcus pneumoniae and RSV were the most common bacterial and viral pathogens identified. Infectious agent detection by PCR provided greater sensitivity than conventional techniques. To our surprise, no relationship was observed between clinical severity and sole or coinfections. Conclusions The use of molecular diagnostics expanded the detection of viruses and atypical bacteria in adults with CAP, as unique or coinfections. Clinical severity and outcome were independent of the aetiological agents detected.

EmsB, a tandem repeated multi-loci microsatellite, new tool to investigate the genetic diversity of Echinococcus multilocularis

In order to explore the genetic diversity within Echinococcus multilocularis (E. multilocularis), the cestode responsible for the alveolar echinococcosis (AE) in humans, a microsatellite, composed of (CA) and (GA) repeats and designated EmsB, was isolated and characterized in view of its nature and potential field application. PCR-amplification with specific primers exhibited a high degree of size polymorphism between E. multilocularis and Echinococcus granulosus sheep (G1) and camel (G6) strains. Fluorescent-PCR was subsequently performed on a panel of E. multilocularis isolates to assess intra-species polymorphism level. EmsB provided a multi-peak profile, characterized by tandemly repeated microsatellite sequences in the E. multilocularis genome. This "repetition of repeats" feature provided to EmsB a high discriminatory power in that eight clusters, supported by bootstrap p-values larger than 95%, could be defined among the tested E. multilocularis samples. We were able to differentiate not only the Alaskan from the European samples, but also to detect different European isolate clusters. In total, 25 genotypes were defined within 37 E. multilocularis samples. Despite its complexity, this tandem repeated multi-loci microsatellite possesses the three important features for a molecular marker, i.e. sensitivity, repetitiveness and discriminatory power. It will permit assessing the genetic polymorphism of E. multilocularis and to investigate its spatial distribution in detail.

Ligation dependent allele specific quantification (LASQ) of CFTR cDNA on the LightCycler using MLPA hybridization probes

BACKGROUND: As for Cystic Fibrosis (CF) and many other hereditary diseases there is still a lack in understanding the relationship between genetic (e.g. allelic) and phenotypic diversity. Therefore methods which allow fine quantification of allelic proportions of mRNA transcripts are of high importance. METHODS: We used either genomic DNA (gDNA) or total RNA extracted from nasal cells as starting nucleic acid template for our assay. The subjects included in this study were 9 CF patients compound heterozygous for the F508del mutation and each one F508del homozygous and one wild type homozygous respectively. We established a novel ligation based quantification method which allows fine quantification of the allelic proportions of ss and ds CFTR cDNA. To verify reliability and accuracy of this novel assay we compared it with semiquantitative fluorescent PCR (SQF-PCR). RESULTS: We established a novel assay for allele specific quantification of gene expression which combines the benefits of the specificity of the ligation reaction and the accuracy of quantitative real-time PCR. The comparison with SQF-PCR clearly demonstrates that LASQ allows fine quantification of allelic proportions. CONCLUSION: This assay represents an alternative to other fine quantitative methods such as ARMS PCR and Pyrosequencing.

Multi-locus microsatellite analysis supports the hypothesis of an autochthonous focus of Echinococcus multilocularis in northern Italy

Echinococcus multilocularis is characterised by a wide geographical distribution, encompassing three continents (North America, Asia and Europe) yet very low genetic variability is documented. Recently, this parasite has been detected in red foxes (Vulpes vulpes) circulating in an Alpine region of Italy, close to Austria. This finding raised the question as to whether an autochthonous cycle exists in Italy or whether the infected foxes originated from the neighbouring regions of Austria. Studies have shown that multi-locus microsatellite analysis can identify genomic regions carrying mutations that result in a local adaptation. We used a tandem repeated multi-locus microsatellite (EmsB) to evaluate the genetic differences amongst adult worms of E. multilocularis collected in Italy, worms from neighbouring Austria and from other European and extra-European countries. Fluorescent PCR was performed on a panel of E. multilocularis samples to assess intra-specific polymorphism. The analysis revealed four closed genotypes for Italian samples of E. multilocularis which were unique compared with the other 25 genotypes from Europe and the five genotypes from Alaska. An analysis in the Alpine watershed, comparing Italian adult worms with those from neighbouring areas in Austria, showed a unique cluster for Italian samples. This result supports the hypothesis of the presence of an autochthonous cycle of E. multilocularis in Italy. EmsB can be useful for 'tracking' the source of infection of this zoonotic parasite and developing appropriate measures for preventing or reducing the risk of human alveolar echinococcosis.

Temporal dynamics of rabbit haemorrhagic disease virus infection in a low-density population of wild rabbits (Oryctolagus cuniculus) in New Zealand

A longitudinal capture-mark-recapture study was conducted to determine the temporal dynamics of rabbit haemorrhagic disease (RHD) in a European rabbit (Oryctolagus cuniculus) population of low to moderate density on sand-hill country in the lower North Island of New Zealand. A combination of sampling ( trapping and radio-tracking) and diagnostic (cELISA, PCR and isotype ELISA) methods was employed to obtain data weekly from May 1998 until June 2001. Although rabbit haemorrhagic disease virus ( RHDV) infection was detected in the study population in all 3 years, disease epidemics were evident only in the late summer or autumn months in 1999 and 2001. Overall, 20% of 385 samples obtained from adult animals older than 11 weeks were seropositive. An RHD outbreak in 1999 contributed to an estimated population decline of 26%. A second RHD epidemic in February 2001 was associated with a population decline of 52% over the subsequent month. Following the outbreaks, the seroprevalence in adult survivors was between 40% and 50%. During 2000, no deaths from RHDV were confirmed and mortalities were predominantly attributed to predation. Influx of seronegative immigrants was greatest in the 1999 and 2001 breeding seasons, and preceded the RHD epidemics in those years. Our data suggest that RHD epidemics require the population immunity level to fall below a threshold where propagation of infection can be maintained through the population.