Bubble detection in Brazil’s stock market: application of the generalized superior augmented Dickey-Fuller test

Considering the importance of the proper detection of bubbles in financial markets for policymakers and market agents, we used two techniques described in Diba and Grossman (1988b) and in Phillips, Shi, and Yu (2015) to detect periods of exuberance in the recent history of the Brazillian stock market. First, a simple cointegration test is applied. Secondly, we conducted several augmented, right-tailed Dickey-Fuller tests on rolling windows of data to determine the point in which there’s a structural break and the series loses its stationarity.

Machine vision methods for process measurements in pulping

The papermaking industry has been continuously developing intelligent solutions to characterize the raw materials it uses, to control the manufacturing process in a robust way, and to guarantee the desired quality of the end product. Based on the much improved imaging techniques and image-based analysis methods, it has become possible to look inside the manufacturing pipeline and propose more effective alternatives to human expertise. This study is focused on the development of image analyses methods for the pulping process of papermaking. Pulping starts with wood disintegration and forming the fiber suspension that is subsequently bleached, mixed with additives and chemicals, and finally dried and shipped to the papermaking mills. At each stage of the process it is important to analyze the properties of the raw material to guarantee the product quality. In order to evaluate properties of fibers, the main component of the pulp suspension, a framework for fiber characterization based on microscopic images is proposed in this thesis as the first contribution. The framework allows computation of fiber length and curl index correlating well with the ground truth values. The bubble detection method, the second contribution, was developed in order to estimate the gas volume at the delignification stage of the pulping process based on high-resolution in-line imaging. The gas volume was estimated accurately and the solution enabled just-in-time process termination whereas the accurate estimation of bubble size categories still remained challenging. As the third contribution of the study, optical flow computation was studied and the methods were successfully applied to pulp flow velocity estimation based on double-exposed images. Finally, a framework for classifying dirt particles in dried pulp sheets, including the semisynthetic ground truth generation, feature selection, and performance comparison of the state-of-the-art classification techniques, was proposed as the fourth contribution. The framework was successfully tested on the semisynthetic and real-world pulp sheet images. These four contributions assist in developing an integrated factory-level vision-based process control.

Air Bubble Entrainment in Hydraulic Jumps: Physical Modelling and Scale Effects

A hydraulic jump is characterised by strong energy dissipation and air entrainment. In the present study, new air-water flow measurements were performed in hydraulic jumps with partially-developed flow conditions in relatively large-size facilities with phase-detection probes. The experiments were conducted with identical Froude numbers, but a range of Reynolds numbers and relative channel widths. The results showed drastic scale effects at small Reynolds numbers in terms of void fraction and bubble count rate distributions. The void fraction distributions implied comparatively greater detrainment at low Reynolds numbers leading to a lesser overall aeration of the jump roller, while dimensionless bubble count rates were drastically lower especially in the mixing layer. The experimental results suggested also that the relative channel width had little effect on the air-water flow properties for identical inflow Froude and Reynolds numbers.

Intestinal content detection in capsule endoscopy using robust features

This work covers two aspects. First, it generally compares and summarizes the similarities and differences of state of the art feature detector and descriptor and second it presents a novel approach of detecting intestinal content (in particular bubbles) in capsule endoscopy images. Feature detectors and descriptors providing invariance to change of perspective, scale, signal-noise-ratio and lighting conditions are important and interesting topics in current research and the number of possible applications seems to be numberless. After analysing a selection of in the literature presented approaches, this work investigates in their suitability for applications information extraction in capsule endoscopy images. Eventually, a very good performing detector of intestinal content in capsule endoscopy images is presented. A accurate detection of intestinal content is crucial for all kinds of machine learning approaches and other analysis on capsule endoscopy studies because they occlude the field of view of the capsule camera and therefore those frames need to be excluded from analysis. As a so called “byproduct” of this investigation a graphical user interface supported Feature Analysis Tool is presented to execute and compare the discussed feature detectors and descriptor on arbitrary images, with configurable parameters and visualized their output. As well the presented bubble classifier is part of this tool and if a ground truth is available (or can also be generated using this tool) a detailed visualization of the validation result will be performed.

A new ultrasonic signal amplification method for detection bacteria

A new method is presented that increases the sensitivity of ultrasound-based techniques for detection of bacteria. The technique was developed for the detection of catalase-positive microorganisms. It uses a bubble trapping medium containing hydrogen peroxide that is mixed with the sample for microbiological evaluation. The enzyme catalase is present in catalase-positive bacteria, which induces a rapid hydrolysis of hydrogen peroxide, forming bubbles which remain in the medium. This reaction results in the amplification of the mechanical changes that the microorganisms produce in the medium. The effect can be detected by means of ultrasonic wave amplitude continuous measurement since the bubbles increase the ultrasonic attenuation significantly. It is shown that microorganism concentrations of the order of 105 cells ml−1 can be detected using this method. This allows an improvement of three orders of magnitude in the ultrasonic detection threshold of microorganisms in conventional culture media, and is competitive with modern rapid microbiological methods. It can also be used for the characterization of the enzymatic activity.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Detection of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.