A recombinant vaccine based on domain II of Plasmodium vivax Apical Membrane Antigen 1 induces high antibody titres in mice

The Apical Membrane Antigen 1 (AMA-1) is considered a promising candidate for development of a malaria vaccine against asexual stages of Plasmodium. We recently identified domain II (DII) of Plasmodium vivax AMA-1 (PvAMA-1) as a highly immunogenic region recognised by IgG antibodies present in many individuals during patent infection with P. vivax. The present study was designed to evaluate the immunogenic properties of a bacterial recombinant protein containing PvAMA-1 DII. To accomplish this, the recombinant protein was administered to mice in the presence of each of the following six adjuvants: Complete/Incomplete Freund`s Adjuvant (CFA/IFA), aluminium hydroxide (Alum), Quil A, QS21 saponin, CpG-ODN 1826 and TiterMax. We found that recombinant DII was highly immunogenic in BALB/c mice when administered in the presence of any of the tested adjuvants. Importantly, we show that DII-specific antibodies recognised the native AMA-1 protein expressed on the surface of P. vivax merozoites isolated from the blood of infected patients. These results demonstrate that a recombinant protein containing PvAMA-1 DII is immunogenic when administered in different adjuvant formulations, and indicate that this region of the AMA-1 protein should continue to be evaluated as part of a subunit vaccine against vivax malaria. (C) 2010 Elsevier Ltd. All rights reserved.

Naturally acquired antibodies against the major merozoite surface coat protein (MSP-1) of Plasmodium falciparum acquired by residents in an endemic area of Colombia

A preliminary baseline epidemiological malaria survey was conducted in the village of Punta Soldado, Colombia. Parasite prevalence and density as well as serological data were obtained from 151 asymptomatic children and adults. Fifty individuals were infected with Plasmodium falciparum. The mean parasite density was 184 parasites/mm3. Greater than 90 of the sample population were P. falciparum antibody positive as detected by the indirect immunofluorescent antibody test (IFAT). The enzyme-linked immunosorbent assay (ELISA) was used to detect antibodies against the major merozoite surface protein (MSP-1) of P. falciparum. In this population, anti-MSP-1 antibody concentration is acquired in an age dependent manner with equal immunogenicity to both the N- and C-terminal regions of the molecule. Infection at the time of sampling was associated with a higher anti-MSP-1 antibody concentration than that found in non-infected individuals. Further studies are planned to assess the role of immune and non-immune factors in limiting the number of cases of severe malaria seen in this population.

Stage-specific activity of potential antimalarial compounds measured in vitro by flow cytometry in comparison to optical microscopy and hypoxanthine uptake

The evaluation of new antimalarial agents using older methods of monitoring sensitivity to antimalarial drugs are laborious and poorly suited to discriminate stage-specific activity. We used flow cytometry to study the effect of established antimalarial compounds, cysteine protease inhibitors, and a quinolone against asexual stages of Plasmodium falciparum. Cultured P. falciparum parasites were treated for 48 h with different drug concentrations and the parasitemia was determined by flow cytometry methods after DNA staining with propidium iodide. P. falciparum erythrocytic life cycle stages were readily distinguished by flow cytometry. Activities of established and new antimalarial compounds measured by flow cytometry were equivalent to results obtained with microscopy and metabolite uptake assays. The antimalarial activity of all compounds was higher against P. falciparum trophozoite stages. Advantages of flow cytometry analysis over traditional assays included higher throughput for data collection, insight into the stage-specificity of antimalarial activity avoiding use of radioactive isotopes.

Ubiquitin proteasome system and the atypical kinase PfPK7 are involved in melatonin signaling in Plasmodium falciparum

We previously reported that melatonin modulates the Plasmodium falciparum erythrocytic cycle by increasing schizont stage population as well as diminishing ring stage population. In addition, the importance of calcium and cAMP in melatonin signaling pathway in P. falciparum was also demonstrated. Nevertheless, the molecular effectors of the indoleamine signaling pathway remain elusive. We now demonstrate by real-time PCR that melatonin treatment up-regulates genes related to ubiquitin/proteasome system (UPS) components and that luzindole, a melatonin receptor antagonist, inhibits UPS transcription modulation. We also show that protein kinase PfPK7, a P. falciparum orphan kinase, plays a crucial role in the melatonin transduction pathway, since following melatonin treatment of P. falciparum parasites where pfpk7 gene is disrupted (pfpk7- parasites) (i) the ratio of asexual stages remain unchanged, (ii) the increase in cytoplasmatic calcium in response to melatonin was strongly diminished and (iii) up-regulation of UPS genes did not occur. The wild-type melatonin-induced alterations in cell cycle features, calcium rise and UPS gene transcription were restored by re-introduction of a functional copy of the pfpk7 gene in the pfpk7- parasites.

The Pf332 gene codes for a megadalton protein of Plasmodium falciparum asexual blood stages

We characterized the Plasmodium falciparum antigen 332 (Ag332) which is specifically expressed during the asexual intraerythrocytic cycle of the parasite. The corresponding Pf332 gene has been located in the subtelomeric region of chromosome 11. Furthermore, it is present in all strais so far analyzed and shows marked restriction length fragment polymorphism. Partial sequence and restriction endonuclease digestion of cloned fragments revealed that the Pf332 gene is composed of highly degenerated repeats rich is glutamic acid. Mung been nuclease digestion and Northern blot analysis suggested that Pf332 gene codes for a protein of about 700 kDa. These data were further confirmed by Western blot and immunoprecipitation of parasites extracts with an antiserum raised against a recombinant clone expressing part of the Ag332. Confocal immunofluorescence showed that Ag332 is translocated from the parasite to the surface of infected red blood cells within vesicle-like structures. In addition, Ag332 was detected on the surface of monkey erythrocytes infected with Plasmodium falciparum.

Mechanisms of protective immunity against asexual blood stages of Plasmodium falciparum in the experimental host Saimiri

In the Saimiri monkey, an experimental host for human malaria, acquired protection against Plasmodium falciparum blood stages depends on the IgG antibody populations developed. In vivo protective anti-falciparum activity of IgG antibodies is correlated with the in vivo opsonizing activity promoting phagocytosis of parasited red bloood cells. In contrast, non protective antibodies inhibit this mechanism by competing at the target level. A similar phenomenon can be and human infection. Anti-cytoadherent and anti-rosette antibodies developed by Saimiri and humans prevent the development of physiopathological events like cerebral malaria which can also occur in this experimental host. Furthermore, transfer to protective human anti-falciparum IgG antibodies into infected Saimiri monkeys exerts an anti parasite activity as efficient as that observed when it is transfered into acute falciparum malaria patients, making the Saimiri an even more attractive host. Studies on the role of immunocompetent cells in the protective immune reponse are still in their infancy, however the existance of a restricted polymorphism of MHC II class molecules in the Saimiri confers additional theoretical and practical importance to this model.

Pilot survey of expressed sequence tags (ESTs) from the asexual blood stages of Plasmodium vivax in human patients

Abstract Background Plasmodium vivax is the most widely distributed human malaria, responsible for 70–80 million clinical cases each year and large socio-economical burdens for countries such as Brazil where it is the most prevalent species. Unfortunately, due to the impossibility of growing this parasite in continuous in vitro culture, research on P. vivax remains largely neglected. Methods A pilot survey of expressed sequence tags (ESTs) from the asexual blood stages of P. vivax was performed. To do so, 1,184 clones from a cDNA library constructed with parasites obtained from 10 different human patients in the Brazilian Amazon were sequenced. Sequences were automatedly processed to remove contaminants and low quality reads. A total of 806 sequences with an average length of 586 bp met such criteria and their clustering revealed 666 distinct events. The consensus sequence of each cluster and the unique sequences of the singlets were used in similarity searches against different databases that included P. vivax, Plasmodium falciparum, Plasmodium yoelii, Plasmodium knowlesi, Apicomplexa and the GenBank non-redundant database. An E-value of <10-30 was used to define a significant database match. ESTs were manually assigned a gene ontology (GO) terminology Results A total of 769 ESTs could be assigned a putative identity based upon sequence similarity to known proteins in GenBank. Moreover, 292 ESTs were annotated and a GO terminology was assigned to 164 of them. Conclusion These are the first ESTs reported for P. vivax and, as such, they represent a valuable resource to assist in the annotation of the P. vivax genome currently being sequenced. Moreover, since the GC-content of the P. vivax genome is strikingly different from that of P. falciparum, these ESTs will help in the validation of gene predictions for P. vivax and to create a gene index of this malaria parasite.

Metabolic oligosaccharide engineering of Plasmodium falciparum intraerythrocytic stages allows direct glycolipid analysis by mass spectrometry

A recent addition to the arsenal of tools for glycome analysis is the use of metabolic labels that allow covalent tagging of glycans with imaging probes. In this work we show that N-azidoglucosamine was successfully incorporated into glycolipidic structures of Plasmodium falciparum intraerythrocytic stages. The ability to tag glycoconjugates selectively with a fluorescent reporter group permits TLC detection of the glycolipids providing a new method to quantify dynamic changes in the glycosylation pattern and facilitating direct mass spectrometry analyses. Presence of glycosylphosphatidylinositol and glycosphingolipid structures was determined in the different extracts. Furthermore, the fluorescent tag was used as internal matrix for the MALDI experiment making even easier the analysis. (C) 2012 Elsevier B.V. All rights reserved.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Immature stages of the moth Lobeza dentilinea (Lepidoptera: Notodontidae), with redescription of the species based on male and female morphology

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Isoprenoid biosynthesis in the erythrocytic stages of Plasmodium falciparum

The development of new drugs is one strategy for malaria control. Biochemical pathways localised in the apicoplast of the parasite, such as the synthesis of isoprenic precursors, are excellent targets because they are different or absent in the human host. Isoprenoids are a large and highly diverse group of natural products with many functions and their synthesis is essential for the parasite's survival. During the last few years, the genes, enzymes, intermediates and mechanisms of this biosynthetic route have been elucidated. In this review, we comment on some aspects of the methylerythritol phosphate pathway and discuss the presence of diverse isoprenic products such as dolichol, ubiquinone, carotenoids, menaquinone and isoprenylated proteins, which are biosynthesised during the intraerythrocytic stages of Plasmodium falciparum.

Factors associated with stages of change for red meat and vegetable intake by Japanese-Brazilians

Stages of change assess individual motivation for lifestyle changes, contributing to the development of more effective intervention strategies. The objective of the present study was to identify factors associated with stages of change for lower intake of red meat and higher intake of vegetables in a cross-sectional analysis of 578 Japanese-Brazilians aged 30-90 years. In adjusted logistic regression models, the odds ratios for women (OR = 1.89; 95%CI: 1.154; 3.103) and physically active individuals (OR = 1.00; 95%CI: 1.000; 1.001) were positively associated with stage of "action" for the higher intake of vegetables. Inverse associations were observed between central obesity (OR = 0.5; 95%CI: 0.351; 0.887) and highest tertile of red meat intake (OR = 0.50; 95%CI: 0.302; 0.817), as well as a positive association between age (OR = 1.04; 95%CI: 1.020; 1.070) and the stage of "action" to the lower intake of meat were verified. Motivation for Japanese-Brazilians to change their food intake was linked to lifestyle. Stage of change is an important factor in mediating food intake behavior change.

High spatial resolution spectroscopy of W51IRS 2E and IRS 2W: Two very massive young stars in early formation stages

We present K-band spectra of the near infrared counterparts to IRS 2E and IRS 2W which is associated with the ultracompact H II region W51d, both of them embedded sources in the Galactic compact H II region W51 IRS 2. The high spatial resolution observations were obtained with the laser guide star facility and Near-infrared Integral Field Spectrograph (NIFS) mounted at the Gemini-North observatory. The spectrum of the ionizing source of W51d shows the photospheric features N III ( 21155 angstrom) in emission and He II ( 21897 angstrom) in absorption which lead us to classify it as a young O3 type star. We detected CO overtone in emission at 23000 angstrom in the spectrum of IRS 2E, suggesting that it is a massive young object still surrounded by an accretion disk, probably transitioning from the hot core phase to an ultracompact H II region.