854 resultados para alumni COM events


Relevância:

30.00% 30.00%

Publicador:

Resumo:

Vols. 10-20 compiled by a staff of editors headed by Charles F. Horne ... and John Rudd ... under the supervision of Rossiter Johnson.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Objective: To determine whether information from genetic risk variants for diabetes is associated with cardiovascular events incidence. Methods: From the about 30 known genes associated with diabetes, we genotyped single-nucleotide polymorphisms at the 10 loci most associated with type-2 diabetes in 425 subjects from the MASS-II Study, a randomized study in patients with multi-vessel coronary artery disease. The combined genetic information was evaluated by number of risk alleles for diabetes. Performance of genetic models relative to major cardiovascular events incidence was analyzed through Kaplan-Meier curve comparison and Cox Hazard Models and the discriminatory ability of models was assessed for cardiovascular events by calculating the area under the ROC curve. Results: Genetic information was able to predict 5-year incidence of major cardiovascular events and overall-mortality in non-diabetic individuals, even after adjustment for potential confounders including fasting glycemia. Non-diabetic individuals with high genetic risk had a similar incidence of events then diabetic individuals (cumulative hazard of 33.0 versus 35.1% of diabetic subjects). The addition of combined genetic information to clinical predictors significantly improved the AUC for cardiovascular events incidence (AUC = 0.641 versus 0.610). Conclusions: Combined information of genetic variants for diabetes risk is associated to major cardiovascular events incidence, including overall mortality, in non-diabetic individuals with coronary artery disease.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Background: Community and clinical data have suggested there is an association between trauma exposure and suicidal behavior (i.e., suicide ideation, plans and attempts). However, few studies have assessed which traumas are uniquely predictive of: the first onset of suicidal behavior, the progression from suicide ideation to plans and attempts, or the persistence of each form of suicidal behavior over time. Moreover, few data are available on such associations in developing countries. The current study addresses each of these issues. Methodology/Principal Findings: Data on trauma exposure and subsequent first onset of suicidal behavior were collected via structured interviews conducted in the households of 102,245 (age 18+) respondents from 21 countries participating in the WHO World Mental Health Surveys. Bivariate and multivariate survival models tested the relationship between the type and number of traumatic events and subsequent suicidal behavior. A range of traumatic events are associated with suicidal behavior, with sexual and interpersonal violence consistently showing the strongest effects. There is a dose-response relationship between the number of traumatic events and suicide ideation/attempt; however, there is decay in the strength of the association with more events. Although a range of traumatic events are associated with the onset of suicide ideation, fewer events predict which people with suicide ideation progress to suicide plan and attempt, or the persistence of suicidal behavior over time. Associations generally are consistent across high-, middle-, and low-income countries. Conclusions/Significance: This study provides more detailed information than previously available on the relationship between traumatic events and suicidal behavior and indicates that this association is fairly consistent across developed and developing countries. These data reinforce the importance of psychological trauma as a major public health problem, and highlight the significance of screening for the presence and accumulation of traumatic exposures as a risk factor for suicide ideation and attempt.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Based on previous results obtained from observations and linear wave theory analysis, the hypothesis that large-scale patterns can generate extreme cold events in southeast South America through the propagation of remotely excited Rossby waves was already suggested. This work will confirm these findings and extend their analysis through a series of numerical experiments using a primitive equation model where waves are excited by a thermal forcing situated in positions chosen according to observed convection anomalies over the equatorial region. The basic state used for these experiments is a composite of austral winters with maximum and minimum frequency of occurrence of generalized frosts that can affect a large area known as the Wet Pampas located in the central and eastern part of Argentina. The results suggest that stationary Rossby waves may be one important mechanism linking anomalous tropical convection with the extreme cold events in the Wet Pampas. The combination of tropical convection and a specific basic state can generate the right environment to guide the Rossby waves trigged by the tropical forcing towards South America. Depending on the phase of the waves entering the South American continent, they can favour the advection of anomalous wind at low levels from the south carrying cold and dry air over the whole southern extreme of the continent, producing a generalized frost in the Wet Pampa region. On the other hand, when a basic state based on the composites of minimum frosts is used, an anomalous anticyclone over the southern part of the continent generates a circulation with a south-southeast wind which brings maritime air and therefore humidity over the Wet Pampas region, creating negative temperature anomalies only over the northeastern part of the region. Under these conditions even if frosts occur they would not be generalized, as observed for the other basic state with maximum frequency of occurrence of generalized frosts.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study characterised the population genetic structure of Plebeia remota through mitochondrial DNA (mtDNA) analysis and evaluated evolutionary and ecological processes that may have contributed to the species current genetic scenario. Seventy feral nests were sampled representing four geographic regions (Cunha, Curitiba, Prudentopolis, and Blumenau). Fifteen composite mtDNA haplotypes were determined and a high genetic structure was detected among all populations. The current population structure may be a result of queen philopatry and vegetation shifts caused by palaeoclimatic changes and uplift of Brazilian coastal ranges. Finally, this study strongly suggests a revision of the taxonomic status of P. remota from the Prudentopolis region.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We numerically study the dynamics of a discrete spring-block model introduced by Olami, Feder, and Christensen (OFC) to mimic earthquakes and investigate to what extent this simple model is able to reproduce the observed spatiotemporal clustering of seismicity. Following a recently proposed method to characterize such clustering by networks of recurrent events [J. Davidsen, P. Grassberger, and M. Paczuski, Geophys. Res. Lett. 33, L11304 (2006)], we find that for synthetic catalogs generated by the OFC model these networks have many nontrivial statistical properties. This includes characteristic degree distributions, very similar to what has been observed for real seismicity. There are, however, also significant differences between the OFC model and earthquake catalogs, indicating that this simple model is insufficient to account for certain aspects of the spatiotemporal clustering of seismicity.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We prove that for any a-mixing stationary process the hitting time of any n-string A(n) converges, when suitably normalized, to an exponential law. We identify the normalization constant lambda(A(n)). A similar statement holds also for the return time. To establish this result we prove two other results of independent interest. First, we show a relation between the rescaled hitting time and the rescaled return time, generalizing a theorem of Haydn, Lacroix and Vaienti. Second, we show that for positive entropy systems, the probability of observing any n-string in n consecutive observations goes to zero as n goes to infinity. (c) 2010 Elsevier B.V. All rights reserved.