A powder X-ray diffraction method for detection of polyprenylated benzophenones in plant extracts associated with HPLC for quantitative analysis

A robust, direct, rapid and non-destructive X-ray diffraction crystallography method to detect the polyprenylated benzophenones 7-epi-clusianone (1) and guttiferone A (2) in extracts from Garcinia brasiliensis is presented. Powder samples of benzophenones 1 and 2, dried hexane extracts from G. brasiliensis seeds and fruit`s pericarp, and the dried ethanolic extract from G. brasiliensis seeds were unambiguously characterized by powder X-ray diffractometry. The calculated X-ray diffraction peaks from crystal structures of analytes 1 and 2, previously determined by single-crystal X-ray diffraction technique, were overlaid to those of the experimental powder diffractograms, providing a practical identification of these compounds in the analyzed material and confirming the pure contents of the powder samples. Using the X-ray diffraction crystallography method, the studied polyprenylated benzophenones were selectively and simultaneously detected in the extracts which were mounted directly on sample holder. In addition, reference materials of the analytes were not required for analyses since the crystal structures of the compounds are known. High performance liquid chromatography analyses also were comparatively carried out to quantify the analytes in the same plant extracts showing to be in agreement with X-ray diffraction crystallography method. (C) 2010 Elsevier B.V. All rights reserved.

An investigation of goethite-seeded Al(OH)3 precipitation using in situ X-ray diffraction and Rietveld-based quantitative phase analysis

An in situ X-ray diffraction investigation of goethite-seeded Al(OH)3 precipitation from synthetic Bayer liquor at 343 K has been performed. The presence of iron oxides and oxyhydroxides in the Bayer process has implications for alumina reversion, which causes significant process losses through unwanted gibbsite precipitation, and is also relevant for the nucleation and growth of scale on mild steel process equipment. The gibbsite, bayerite and nordstrandite polymorphs of Al(OH)3 precipitated from the liquor; gibbsite appeared to precipitate first, with subsequent formation of bayerite and nordstrandite. A Rietveld-based approach to quantitative phase analysis was implemented for the determination of absolute phase abundances as a function of time, from which kinetic information for the formation of the Al(OH)3 phases was determined.

Apparent shortening of the Csp(3)-Csp(3) bond analysed via a variable-temperature X-ray diffraction study in racemic 1,1 '-binaphthalene-2,2 '-diyl diethyl bis(carbonate)

Crystal structure determination at room temperature [292 (2) K] of racemic 1,1'-binaphthalene-2,2'-diyl diethyl bis(carbonate), C26H22O6, showed that one of the terminal carbon-carbon bond lengths is very short [Csp(3)-Csp(3) = 1.327 (6) angstrom]. The reason for such a short bond length has been analysed by collecting data sets on the same crystal at 393, 150 and 90 K. The values of the corrected bond lengths clearly suggest that the shortening is mainly due to positional disorder at two sites, with minor perturbations arising as a result of thermal vibrations. The positional disorder has been resolved in the analysis of the 90 K data following the changes in the unit-cell parameters for the data sets at 150 and 90 K, which appear to be an artifact of a near centre of symmetry relationship between the two independent molecules in the space group P (1) over bar at these temperatures. Indeed, the unit cell at low temperature (150 and 90 K) is a supercell of the room-temperature unit cell.

Systematic study on crystal-contact engineering of diphthine synthase: influence of mutations at crystal-packing regions on X-ray diffraction quality

It is well known that protein crystallizability can be influenced by site-directed mutagenesis of residues on the molecular surface of proteins, indicating that the intermolecular interactions in crystal-packing regions may play a crucial role in the structural regularity at atomic resolution of protein crystals. Here, a systematic examination was made of the improvement in the diffraction resolution of protein crystals on introducing a single mutation of a crystal-packing residue in order to provide more favourable packing interactions, using diphthine synthase from Pyrococcus horikoshii OT3 as a model system. All of a total of 21 designed mutants at 13 different crystal-packing residues yielded almost isomorphous crystals from the same crystallization conditions as those used for the wild-type crystals, which diffracted X-rays to 2.1 angstrom resolution. Of the 21 mutants, eight provided crystals with an improved resolution of 1.8 angstrom or better. Thus, it has been clarified that crystal quality can be improved by introducing a suitable single mutation of a crystal-packing residue. In the improved crystals, more intimate crystal-packing interactions than those in the wild-type crystal are observed. Notably, the mutants K49R and T146R yielded crystals with outstandingly improved resolutions of 1.5 and 1.6 angstrom, respectively, in which a large-scale rearrangement of packing interactions was unexpectedly observed despite the retention of the same isomorphous crystal form. In contrast, the mutants that provided results that were in good agreement with the designed putative structures tended to achieve only moderate improvements in resolution of up to 1.75 angstrom. These results suggest a difficulty in the rational prediction of highly effective mutations in crystal engineering.

Crystallization and preliminary X-ray diffraction analysis of naphthalene dioxygenase from Rhodococcus sp strain NCIMB 12038

The three-component naphthalene dioxygenase (NDO) enzyme system carries out the first step in the aerobic degradation of naphthalene to (+)-cis-(1R,2S)-dihydroxy-1,2-dihydronaphthalene by Rhodococcus sp. strain NCIMB 12038. The terminal oxygenase component (naphthalene 1,2-dioxygenase) that catalyzes this reaction belongs to the aromatic ring hydroxylating dioxygenase family and has been crystallized. These enzymes utilize a mononuclear nonheme iron centre to catalyze the addition of dioxygen to their respective substrates. In this reaction, two electrons, two protons and a dioxygen molecule are consumed. The Rhodococcus enzyme has only 33 and 29% sequence identity to the corresponding alpha- and beta-subunits of the NDO system of Pseudomonas putida NCIMB 9816-4, for which the tertiary structure has been reported. In order to determine the three-dimensional structure of the Rhodococcus NDO, diffraction-quality crystals have been prepared by the hanging-drop method. The crystals belongs to space group P2(1)2(1)2(1), with unit-cell parameters a = 87.5, b = 144, c = 185.6 Angstrom, alpha = beta = gamma = 90degrees, and diffract to 2.3 Angstrom resolution.

An EXAFS, X-ray diffraction, and electrochemical investigation of 1-alkyl-3-methylimidazolium salts of [{UO2(NO3)(2)}(2)(mu(4)-C2O4)](2-)

The structure of the 1-alkyl-3-methylimidazolium salts of the dinuclear mu(4)-(O,O,O',O'-ethane-1,2-dioato)-bis[bis(nitrato-O,O)dioxouranate(VI)] anion have been investigated using single crystal X-ray crystallography. In addition, EXAFS and electrochemical studies have been performed on the [C(4)mim](+) salt which is formed following the oxidative dissolution of uranium(IV) oxide in [C(4)mim][NO3]. EXAFS analysis of the solution following UO2 dissolution indicates a mixture of uranyl nitrate and mu(4)-(O,O,O',O'-ethane-1,2-dioato)-bis[bis(nitrato-O,O)dioxouranate(VI)] anions are formed.

The measured variation of the Debye-Waller factor of aluminum from 295K to 815K by using the energy dispersive x-ray diffraction technique

The Energy Dispersive X-ray Diffraction System at Brock University has been used to measure the intensities of the diffraction lines of aluminum powder sample as a function of temperature. At first, intensity measurements at high temperature were not reproducible. After some modifications have been made, we were able to measure the intensities of the diffraction lines to 815K, with good accuracy and reproducibility. Therefore the changes of the Debye-Waller factor from room temperature up to 815K for aluminum were determined with precision. Our results are in good agreement with those previously published.

X-ray diffraction from Al powder using energy dispersive technique

Using the energy dispersive x ...ray diffraction (EDXD) technique, the room temperature diffraction pattern of Al powder was obtained at diffraction angles ~ 30° and 50°. From the small angle diffraction pattern the average relative intensities (IR) of the (111), (200), and (220) lines were measured to be equal to 100, 62, and 32 respectively. From the large diffraction angle IR for the (220), (311+222), (400), (331+420), and (422) lines were measured to be 100,201,17,90, and 19.5 respectively. The diffraction pattern at those two angles were obtained at several higher temperatures to measure the change in the intensities of the Al lines. From the intensity changes the increase of the Debye- Waller temperature factor, i.e ~B(T), with respect to the value at room temperature was determined to be 0.6+0.1 at 250°C, 1.10+0.15 at 350°C, 1.45+0.20 at 450°C, and 2.20±0.35 at 550°C.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

Preliminary X-ray diffraction analysis of YqjH from Escherichia coli: a putative cytoplasmic ferri-siderophore reductase

YqjH is a cytoplasmic FAD-containing protein from Escherichia coli; based on homology to ViuB of Vibrio cholerae, it potentially acts as a ferri-siderophore reductase. This work describes its overexpression, purification, crystallization and structure solution at 3.0 A resolution. YqjH shares high sequence similarity with a number of known siderophore-interacting proteins and its structure was solved by molecular replacement using the siderophore-interacting protein from Shewanella putrefaciens as the search model. The YqjH structure resembles those of other members of the NAD(P)H:flavin oxidoreductase superfamily.

In situ X-ray diffraction studies of phase transition in Pb1-x La x Zr0.40Ti0.60O3 ferroelectric ceramics

The temperature dependence of the crystalline structure and the lattice parameters of Pb1-xLaxZr0.40Ti0.60O3 ferroelectric ceramic system with 0.00 x 0.21 was determined. The samples with x 0.11 show a cubic-to-tetragonal phase transition at the maximum dielectric permittivity, Tmax. Above this amount and especially for the x = 0.12 sample, a spontaneous phase transition from a relaxor ferroelectric state (cubic phase) to a ferroelectric state (tetragonal phase) is observed upon cooling below the Tmax. Unlike what has been reported in other studies, the x = 0.13, 0.14, and 0.15 samples, which present a more pronounced relaxor behavior, also presents a spontaneous normal-to-relaxor transition, indicated by a cubic to tetragonal symmetry below the Tmax. The origin of this anomaly has been associated with an increase in the degree of tetragonality, confirmed by the measurements of the X-ray diffraction patterns. The differential thermal analysis (DSC) measurements also confirm the existence of these phase transitions.

Crystallization and preliminary X-ray diffraction analysis of a eumenine mastoparan toxin: a new class of mast-cell degranulating peptide in the wasp venom

Mastoparans are tetradecapeptides found to be the major component of vespid venoms. A mastoparan toxin isolated from the venom of Anterhynchium flavomarginatum micado has been crystallized and X-ray diffraction data collected to 2.7 Angstrom resolution using a synchrotron-radiation source. Crystals were determined to belong to the space group P6(2)22 (P6(4)22). This is the first mastoparan to be crystallized and will provide further insights into the conformational significance of mastoparan toxins with respect to their potency and activity in G-protein regulation.

Crystallization and preliminary X-ray diffraction analysis of importin-alpha acomplexed with NLS peptidomimetics

Importin-alpha is the nuclear import receptor that recognizes cargo proteins with nuclear localization sequences (NLSs). Tile study of NLS peptidomimetics can provide a better understanding of the requirements for the molecular recognition of cargo proteins by importin-alpha, and potentially engender a large number of applications in medicine. Importin-a was crystallized with a set of six NLS peptidomimetics, and X-ray diffraction data were collected in the range 2.1-2.5 angstrom resolution. Preliminary electron density calculations show that the ligands are present in the crystals. (c) 2005 Elsevier B.V All rights reserved.

Crystallization and preliminary X-ray diffraction analysis of an acidic phospholipase A(2) complexed with p-bromophenacyl bromide and alpha-tocopherol inhibitors at 1.9-and 1.45-A resolution

An acidic phospholipase A(2) (PLA(2)) isolated from Bothrops jararacussu snake venom was crystallized with two inhibitors: alpha-tocopherol (vitamin E) and p-bromophenacyl bromide (BPB). The crystals diffracted at 1.45- and 1.85-Angstrom resolution, respectively, for the complexes with alpha-tocopherol and p-bromophenacyl bromide. The crystals are not isomorphous with those of the native protein, suggesting the inhibitors binding was successful and changes in the quaternary structure may have occurred. (C) 2004 Elsevier B.V. All rights reserved.