Structure and stability of human telomeric sequence

Telomeric DNA of a variety of vertebrates including humans contains the tandem repeat d(TTAGGG)(n). We have investigated the structural properties of the human telomeric repeat oligonucleotide models d(T(2)AG(3))(4), d(G(3)T(2)A)(3)G(3), and d(G(3)T(2)AG(3)) using CD, gel electrophoresis, and chemical probing techniques. The sequences d(G(3)T(2)A)(3)G(3) and d(T(2)AG(3))(4) assume an antiparallel G quartet structure by intramolecular folding, while the sequence d(G(3)T(2)AG(3)) also adopts an antiparallel G quartet structure but by dimerization of hairpins. In all the above cases, adenines are in the loop. The TTA loops are oriented at the same end of the G tetrad stem in the case of hairpin dimer. Further, the oligonucleotide D(G(3)T(2)AG(3)) forms a higher order structure by the association of two hairpin dimers via stacking of G tetrad planes. Here we show that N-7 of adenine in the hairpin dimer is Hoogsteen hydrogen-bonded. The partial reactivity of loop adenines with DEPC in d(T(2)AG(3))(4) suggests that the intramolecular G quartet structure is highly polymorphic and structures with different loop orientations and topologies are formed in solution. Intra- and interloop hydrogen bonding schemes for the TTA loops are proposed to account for the observed diethyl pyrocarbonate reactivities of adenines. Sodium-induced G quartet structures differ from their potassium-induced counterparts not only in stability but also in loop conformation and interactions. Thus, the overall structure and stability of telomeric sequences are modulated by the cation present, loop sequence, and the number of G tracts, which might be important for the telomere function.

Vaccinia virus DNA replication: two hundred base pairs of telomeric sequence confer optimal replication efficiency on minichromosome templates.

Vaccinia virus is a complex DNA virus that exhibits significant genetic and physical autonomy from the host cell. Most if not all of the functions involved in replication and transcription of the 192-kb genome are virally encoded. Although significant progress has been made in identifying trans-acting factors involved in DNA synthesis, the mechanism of genome replication has remained poorly understood. The genome is a linear duplex with covalently closed hairpin termini, and it has been presumed that sequences and/or structures within these termini are important for the initiation of genome replication. In this report we describe the construction of minichromosomes containing a central plasmid insert flanked by hairpin termini derived from the viral genome and their use as replication templates. When replication of these minichromosomes was compared with a control substrate containing synthetic hairpin termini, specificity for viral telomeres was apparent. Inclusion of > or = 200 bp from the viral telomere was sufficient to confer optimal replication efficiency, whereas 65-bp telomeres were not effective. Chimeric 200-bp telomeres containing the 65-bp terminal element and 135 bp of ectopic sequence also failed to confer efficient replication, providing additional evidence that telomere function is sequence-specific. Replication of these exogenous templates was dependent upon the viral replication machinery, was temporally coincident with viral replication, and generated covalently closed minichromosome products. These data provide compelling evidence for specificity in template recognition and utilization in vaccinia virus-infected cells.

New insights into telomeric DNA sequence (TTAGGG)n location in bat chromosomes

Molossidae species, Cynomops abrasus (2n = 34, fundamental number, FN = 64), Eumops auripendulus (2n = 42, FN = 62), Molossus rufus (2n = 48, FN = 64), Molossops temminckii (2n = 48, FN = 64), and Nyctinomops laticaudatus (2n = 48, FN = 64), and Phyllostomidae species, Phyllostomus discolor (2n = 32, FN = 60), have karyotypes with different chromosome and fundamental numbers, different localization of constitutive heterochromatin, and different numbers and location of nucleolar organizer regions (NORs). Fluorescence in situ hybridization with a human probe of the telomeric sequence (TTAGGG)n produced fluorescent signals in telomeric regions of the six bat species' chromosomes; in E. auripendulus, pericentromeric signals were also observed in the acrocentric and subtelocentric chromosomes. A relationship between telomeric sequences and NORs, and between telomeric sequences and constitutive heterochromatin was detected in chromosomes bearing NORs in C. abrasus, M. temminckii, N. laticaudatus, and P. discolor. No interstitial signal was observed in the meta- or submetacentric chromosomes of these species. ©FUNPEC-RP.

Intraloop and Interloop Interactions in the Folded-G Quartet Structure of Oxytricha Telomeric Sesquence

The antiparallel intramolecular G quartet structure for the 3.5 copy Oxytricha telomeric sequence d(G(4)T(4))(3)G4 has been established using a combination of spectroscopic and chemical probing methods. In the presence of Naf ions, this sequence exhibits a circular dichroism spectrum with a positive band at 295 nm and a negative band around 265 nm, characteristic of an antiparallel G quartet structure. Further, we show that d(G(4)T(4))(3)G(4) adopts an antiparallel intramolecular G quartet structure even in K+ unlike d(G(4)T(4)G(4)). KMnO4 probing experiments indicated the existence of intra and interloop interactions in the Na+ induced structure. We have found that K+ not only increases the thermal stability of,G quartet structure but also binds to the loop region and disrupts stacking and interloop interactions. Biological consequences of such cation-dependent conformational micro-heterogeneity in the loop region of G quartet structures is also discussed.

Stabilization and Structural Alteration of the G-Quadruplex DNA Made from the Human Telomeric Repeat Mediated by Troger's Base Based Novel Benzimidazole Derivatives

Ligand-induced stabilization of the G-quadruplex DNA structure derived from the single-stranded 3'-overhang of the telomeric DNA is an attractive strategy for the inhibition of the telomerase activity. The agents that can induce/stabilize a DNA sequence into a G-quadruplex structure are therefore potential anticancer drugs. Herein we present the first report of the interactions of two novel bisbenzimidazoles (TBBz1 and TBBz2) based on Troger's base skeleton with the G-quadruplex DNA (G4DNA). These Troger's base molecules stabilize the G4DNA derived from a human telomeric sequence. Evidence of their strong interaction with the G4DNA has been obtained from CD spectroscopy, thermal denaturation, and UV-vis titration studies. These ligands also possess significantly higher affinity toward the G4DNA over the duplex DNA. The above results obtained are in excellent agreement with the biological activity, measured in vitro using a modified TRAP assay. Furthermore, the ligands are selectively more cytotoxic toward the cancerous cells than the corresponding noncancerous cells. Computational studies suggested that the adaptive scaffold might allow these ligands to occupy not only the G-quartet planes but also the grooves of the G4DNA.

Targeting human telomeric G-quadruplex DNA with curcumin and its synthesized analogues under molecular crowding conditions

The formation of telomeric G-quadruplexes has been shown to inhibit telomerase activity. Indeed, a number of small molecules capable of p-stacking with G-tetrads have shown the ability to inhibit telomerase activity through the stabilization of G-quadruplexes. Curcumin displays a wide spectrum of medicinal properties ranging from anti-bacterial, anti-viral, anti-protozoal, anti-fungal and anti-inflammatory to anti-cancer activity. We have investigated the interactions of curcumin and its structural analogues with the human telomeric sequence AG(3)(T(2)AG(3))(3) under molecular crowding conditions. Experimental studies indicated the existence of a AG(3)(T(2)AG(3))(3)/curcumin complex with binding affinity of 0.72 x 10(6) M-1 under molecular crowding conditions. The results from UV-visible absorption spectroscopy, a fluorescent TO displacement assay, circular dichroism and molecular docking studies, imply that curcumin and their analogues interact with G-quadruplex DNA via groove binding. While other analogs of curcumin studied here bind to G-quadruplexes in a qualitatively similar manner their affinities are relatively lower in comparison to curcumin. The Knoevenagel condensate, a methoxy-benzylidene derivative of curcumin, also exhibited significant binding to G-quadruplex DNA, although with two times decreased affinity. Our study establishes the potential of curcumin as a promising natural product for G-quadruplex specific ligands.

Targeting human telomeric G-quadruplex DNA with curcumin and its synthesized analogues under molecular crowding conditions

The formation of telomeric G-quadruplexes has been shown to inhibit telomerase activity. Indeed, a number of small molecules capable of p-stacking with G-tetrads have shown the ability to inhibit telomerase activity through the stabilization of G-quadruplexes. Curcumin displays a wide spectrum of medicinal properties ranging from anti-bacterial, anti-viral, anti-protozoal, anti-fungal and anti-inflammatory to anti-cancer activity. We have investigated the interactions of curcumin and its structural analogues with the human telomeric sequence AG(3)(T(2)AG(3))(3) under molecular crowding conditions. Experimental studies indicated the existence of a AG(3)(T(2)AG(3))(3)/curcumin complex with binding affinity of 0.72 x 10(6) M-1 under molecular crowding conditions. The results from UV-visible absorption spectroscopy, a fluorescent TO displacement assay, circular dichroism and molecular docking studies, imply that curcumin and their analogues interact with G-quadruplex DNA via groove binding. While other analogs of curcumin studied here bind to G-quadruplexes in a qualitatively similar manner their affinities are relatively lower in comparison to curcumin. The Knoevenagel condensate, a methoxy-benzylidene derivative of curcumin, also exhibited significant binding to G-quadruplex DNA, although with two times decreased affinity. Our study establishes the potential of curcumin as a promising natural product for G-quadruplex specific ligands.

Small-Molecule Selectively Recognizes Human Telomeric G-Quadruplex DNA and Regulates Its Conformational Switch

Structural complexity is an inherent feature of the human telomeric sequence, and it presents a major challenge for developing ligands of pharmaceutical interest. Recent studies have pointed out that the induction of a quadruplex or change of a quadruplex conformation on binding may be the most powerful method to exert the desired biological effect. In this study, we demonstrate a quadruplex ligand that binds selectively to different forms of the human telomeric G-quadruplex structure and regulates its conformational switch. The results show that not only can oxazine750 selectively induce parallel quadruplex formation from a random coil telomeric oligonucleotide, in the absence of added cations, it also can easily surpass the energy barrier between two structures and change the G-quadruplex conformation in Na+ or K+ solution. The combination of its unique properties, including the size and shape of the G-quadruplex and the small molecule, is proposed as the predominant force for regulating the special structural formation and transitions.

Intrachromosomal distribution of telomeric repeats in Eumops glaucinus and eumops perotis (Molossidae, Chiroptera)

The location of chromosomal telomeric repeats (TTAGGG)(n) was investigated in two species of the Molossidae family, Eumops glaucinus and Eumops perotis. The diploid chromosome number (2n) is 40 in E. glaucinus and 48 in E. perotis and the fundamental numbers (FN) are 64 and 58, respectively. It has been suggested that the E. glaucinus karyotype has evolved from the E. perotis karyotype through Robertsonian fusion events. In the present study, the telomeric sequences were detected at the termini of chromosomes in both species. In addition, E. glaucinus also displayed telomeric repeats in centromeric and pericentromeric regions in almost all biarmed chromosomes. Conversely, in E. perotis pericentromeric signals were only observed in two biarmed chromosomes. In both E. glaucinus and E. perotis, such telomeric sequences were observed as part of the heterochromatin. The interstitial sites of telomeric sequences suggest that they are remnants of telomeres of ancestral chromosomes that participated in the fusion event.

Targeting DNA repeat sequences with Py-Im polyamides

Hairpin pyrrole-imdazole polyamides are cell-permeable, sequence-programmable oligomers that bind in the minor groove of DNA. This thesis describes studies of Py-Im polyamides targeted to biologically important DNA repeat sequences for the purpose of modulating disease states. Design of a hairpin polyamide that binds the CG dyad, a site of DNA methylation that can become dysregulated in cancer, is described. We report the synthesis of a DNA methylation antagonist, its sequence specificity and affinity informed by Bind-n-Seq and iteratively designed, which improves inhibitory activity in a cell-free assay by 1000-fold to low nanomolar IC50. Additionally, a hairpin polyamide targeted to the telomeric sequence is found to trigger a slow necrotic-type cell death with the release of inflammatory molecules in a model of B cell lymphoma. The effects of the polyamide are unique in this class of oligomers; its effects are characterized and a functional assay of phagocytosis by macrophages is described. Additionally, hairpin polyamides targeted to pathologically expanded CTG•CAG triplet repeat DNA sequences, the molecular cause of myotonic dystrophy type 1, are synthesized and assessed for toxicity. Lastly, ChIP-seq of Hypoxia-Inducible Factor is performed under hypoxia-induced conditions. The study results show that ChIP-seq can be employed to understand the genome-wide perturbation of Hypoxia-Inducible Factor occupancy by a Py-Im polyamide.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

In situ hybridization of bat chromosomes with human (TTAGGG)n probe, after previous digestion with Alu I

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Análise citogenética em espécies de Vespertilionidae dos gêneros Eptesicus, Histiotus, Lasiurus e Myotis (Chiroptera, Mammalia)

Pós-graduação em Genética - IBILCE

Mapeamento físico de genes ribosomais 18S e 5S nos cromossomos de espécies simpáticas do gênero Gymnotus (Teleostei, Gymnotiformes, Gymnotidae)

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Aplicação de pintura cromossômica em espécies da família Accipitridae (Aves, Falconiformes): considerações filogenéticas e evolutivas

As análises citogenéticas de diversos Falconiformes mostraram que os acipitrídeos têm uma organização cromossômica atípica na classe Aves, com um número diplóide relativamente baixo (média de 2n= 66) e poucos pares de microcromossomos (4 a 6 pares). Propostas baseadas em citogenética clássica sugeriram que esse fato devia-se à fusão de microcromossomos presentes no cariótipo ancestral das Aves. No intuito de contribuir para o esclarecimento das questões referentes à evolução cromossômica e filogenética dessa família, três espécies da subfamília Buteoninae (Rupornis magnirostris, Buteogallus meridionales e Asturina nitida) e duas espécies da subfamília Harpiinae (Harpia harpyja e Morphnus guianensis) foram analisados citogeneticamente através da aplicação de técnicas de citogenética clássica e molecular. As espécies de Buteoninae apresentaram cariótipos muito semelhantes, com número diplóide igual a 68; o número de cromossomos de dois braços entre 17 e 21, o cromossomo Z submetacêntrico e o W metacêntrico em R. magnirostris e submetacêntrico em Asturina nitida. O uso de sondas de 18/28S rDNA mostrou a localização de regiões organizadoras de nucléolo em um par submetacêntrico médio nas três espécies, correspondendo ao braço curto do par 7. Sequências teloméricas foram mapeadas não só na região terminal dos braços, mas também em algumas posições intersticiais. Sondas de cromossomo inteiro derivadas dos pares 1 a 10 de Gallus gallus (GGA) produziram o mesmo número de sinais nessas três espécies. A disponibilidade das sondas de cromossomos totais derivadas de Leucopternis albicollis confirmou a existência de uma assinatura citogenética comum para as espécies de Buteoninae analisadas por FISH, que se trata da associação entre GGA1p e GGA6, inclusive com um sítio de sequência telomérica intersticial reforçando esse fato. As espécies de Harpiinae analisadas mostraram que o número diplóide das espécies de H. harpyja e M. guianensis foi igual a 58 e 54, respectivamente, e que ambas as espécies apresentam vinte e dois pares de cromossomos de dois braços, mesmo Harpia apresentando dois pares a mais. 18/28S rDNA produziram sinais no braço curto do par 1 em M. guianensis e em dois pares em H. harpyja (pares 6 e 25). Sequências teloméricas intersticiais também foram observadas em alguns pares. Apesar da similaridade na morfologia cromossômica, não foram observadas associações compartilhadas por essas duas espécies. As diferentes associações observadas em Morphnus e Harpia mostram que essas espécies sofreram uma reorganização genômica expressiva após sua separação em linhagens independentes. Além disso, ausência de associações semelhantes sugere que houve fissões nos macrocromossomos do ancestral em comum desse grupo, e as fusões foram subsequentes ao seu isolamento como linhagens diferentes. Os resultados aqui apresentados, somados àqueles publicados anteriormente com outras espécies de Accipitridae indicam que os processos de fissões envolvendo os macrocromossomos de GGA e fusões entre esses segmentos e entre esses e microcromossomos são rearranjos recorrentes nesse grupo. Apesar dos Falconidae também apresentarem cariótipos atípicos, e números diploides baixos, os dados globais da citogenética de Accipitridae indicam que, assim como postulado para as semelhanças morfológicas entre esses dois grupos, os cariótipos rearranjados corresponderiam a homoplasias, do ponto de vista evolutivo, apoiando que essas duas famílias não formam um grupo monofilético.