Vaccinia virus DNA replication: two hundred base pairs of telomeric sequence confer optimal replication efficiency on minichromosome templates.

Vaccinia virus is a complex DNA virus that exhibits significant genetic and physical autonomy from the host cell. Most if not all of the functions involved in replication and transcription of the 192-kb genome are virally encoded. Although significant progress has been made in identifying trans-acting factors involved in DNA synthesis, the mechanism of genome replication has remained poorly understood. The genome is a linear duplex with covalently closed hairpin termini, and it has been presumed that sequences and/or structures within these termini are important for the initiation of genome replication. In this report we describe the construction of minichromosomes containing a central plasmid insert flanked by hairpin termini derived from the viral genome and their use as replication templates. When replication of these minichromosomes was compared with a control substrate containing synthetic hairpin termini, specificity for viral telomeres was apparent. Inclusion of > or = 200 bp from the viral telomere was sufficient to confer optimal replication efficiency, whereas 65-bp telomeres were not effective. Chimeric 200-bp telomeres containing the 65-bp terminal element and 135 bp of ectopic sequence also failed to confer efficient replication, providing additional evidence that telomere function is sequence-specific. Replication of these exogenous templates was dependent upon the viral replication machinery, was temporally coincident with viral replication, and generated covalently closed minichromosome products. These data provide compelling evidence for specificity in template recognition and utilization in vaccinia virus-infected cells.

New insights into telomeric DNA sequence (TTAGGG)n location in bat chromosomes

Molossidae species, Cynomops abrasus (2n = 34, fundamental number, FN = 64), Eumops auripendulus (2n = 42, FN = 62), Molossus rufus (2n = 48, FN = 64), Molossops temminckii (2n = 48, FN = 64), and Nyctinomops laticaudatus (2n = 48, FN = 64), and Phyllostomidae species, Phyllostomus discolor (2n = 32, FN = 60), have karyotypes with different chromosome and fundamental numbers, different localization of constitutive heterochromatin, and different numbers and location of nucleolar organizer regions (NORs). Fluorescence in situ hybridization with a human probe of the telomeric sequence (TTAGGG)n produced fluorescent signals in telomeric regions of the six bat species' chromosomes; in E. auripendulus, pericentromeric signals were also observed in the acrocentric and subtelocentric chromosomes. A relationship between telomeric sequences and NORs, and between telomeric sequences and constitutive heterochromatin was detected in chromosomes bearing NORs in C. abrasus, M. temminckii, N. laticaudatus, and P. discolor. No interstitial signal was observed in the meta- or submetacentric chromosomes of these species. ©FUNPEC-RP.

Intrachromosomal distribution of telomeric repeats in Eumops glaucinus and eumops perotis (Molossidae, Chiroptera)

The location of chromosomal telomeric repeats (TTAGGG)(n) was investigated in two species of the Molossidae family, Eumops glaucinus and Eumops perotis. The diploid chromosome number (2n) is 40 in E. glaucinus and 48 in E. perotis and the fundamental numbers (FN) are 64 and 58, respectively. It has been suggested that the E. glaucinus karyotype has evolved from the E. perotis karyotype through Robertsonian fusion events. In the present study, the telomeric sequences were detected at the termini of chromosomes in both species. In addition, E. glaucinus also displayed telomeric repeats in centromeric and pericentromeric regions in almost all biarmed chromosomes. Conversely, in E. perotis pericentromeric signals were only observed in two biarmed chromosomes. In both E. glaucinus and E. perotis, such telomeric sequences were observed as part of the heterochromatin. The interstitial sites of telomeric sequences suggest that they are remnants of telomeres of ancestral chromosomes that participated in the fusion event.

Combined neutron and X-ray diffraction studies of DNA in crystals and solutions

Recent developments in instrumentation and facilities for sample preparation have resulted in sharply increased interest in the application of neutron diffraction. Of particular interest are combined approaches in which neutron methods are used in parallel with X-ray techniques. Two distinct examples are given. The first is a single-crystal study of an A-DNA structure formed by the oligonucleotide d(AGGGGCCCCT)2, showing evidence of unusual base protonation that is not visible by X-ray crystallography. The second is a solution scattering study of the interaction of a bisacridine derivative with the human telomeric sequence d(AGGGTTAGGGTTAGGGTTAGGG) and illustrates the differing effects of NaCl and KCl on this interaction.

In situ hybridization of bat chromosomes with human (TTAGGG)n probe, after previous digestion with Alu I

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Análise citogenética em espécies de Vespertilionidae dos gêneros Eptesicus, Histiotus, Lasiurus e Myotis (Chiroptera, Mammalia)

Pós-graduação em Genética - IBILCE

Mapeamento físico de genes ribosomais 18S e 5S nos cromossomos de espécies simpáticas do gênero Gymnotus (Teleostei, Gymnotiformes, Gymnotidae)

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Aplicação de pintura cromossômica em espécies da família Accipitridae (Aves, Falconiformes): considerações filogenéticas e evolutivas

As análises citogenéticas de diversos Falconiformes mostraram que os acipitrídeos têm uma organização cromossômica atípica na classe Aves, com um número diplóide relativamente baixo (média de 2n= 66) e poucos pares de microcromossomos (4 a 6 pares). Propostas baseadas em citogenética clássica sugeriram que esse fato devia-se à fusão de microcromossomos presentes no cariótipo ancestral das Aves. No intuito de contribuir para o esclarecimento das questões referentes à evolução cromossômica e filogenética dessa família, três espécies da subfamília Buteoninae (Rupornis magnirostris, Buteogallus meridionales e Asturina nitida) e duas espécies da subfamília Harpiinae (Harpia harpyja e Morphnus guianensis) foram analisados citogeneticamente através da aplicação de técnicas de citogenética clássica e molecular. As espécies de Buteoninae apresentaram cariótipos muito semelhantes, com número diplóide igual a 68; o número de cromossomos de dois braços entre 17 e 21, o cromossomo Z submetacêntrico e o W metacêntrico em R. magnirostris e submetacêntrico em Asturina nitida. O uso de sondas de 18/28S rDNA mostrou a localização de regiões organizadoras de nucléolo em um par submetacêntrico médio nas três espécies, correspondendo ao braço curto do par 7. Sequências teloméricas foram mapeadas não só na região terminal dos braços, mas também em algumas posições intersticiais. Sondas de cromossomo inteiro derivadas dos pares 1 a 10 de Gallus gallus (GGA) produziram o mesmo número de sinais nessas três espécies. A disponibilidade das sondas de cromossomos totais derivadas de Leucopternis albicollis confirmou a existência de uma assinatura citogenética comum para as espécies de Buteoninae analisadas por FISH, que se trata da associação entre GGA1p e GGA6, inclusive com um sítio de sequência telomérica intersticial reforçando esse fato. As espécies de Harpiinae analisadas mostraram que o número diplóide das espécies de H. harpyja e M. guianensis foi igual a 58 e 54, respectivamente, e que ambas as espécies apresentam vinte e dois pares de cromossomos de dois braços, mesmo Harpia apresentando dois pares a mais. 18/28S rDNA produziram sinais no braço curto do par 1 em M. guianensis e em dois pares em H. harpyja (pares 6 e 25). Sequências teloméricas intersticiais também foram observadas em alguns pares. Apesar da similaridade na morfologia cromossômica, não foram observadas associações compartilhadas por essas duas espécies. As diferentes associações observadas em Morphnus e Harpia mostram que essas espécies sofreram uma reorganização genômica expressiva após sua separação em linhagens independentes. Além disso, ausência de associações semelhantes sugere que houve fissões nos macrocromossomos do ancestral em comum desse grupo, e as fusões foram subsequentes ao seu isolamento como linhagens diferentes. Os resultados aqui apresentados, somados àqueles publicados anteriormente com outras espécies de Accipitridae indicam que os processos de fissões envolvendo os macrocromossomos de GGA e fusões entre esses segmentos e entre esses e microcromossomos são rearranjos recorrentes nesse grupo. Apesar dos Falconidae também apresentarem cariótipos atípicos, e números diploides baixos, os dados globais da citogenética de Accipitridae indicam que, assim como postulado para as semelhanças morfológicas entre esses dois grupos, os cariótipos rearranjados corresponderiam a homoplasias, do ponto de vista evolutivo, apoiando que essas duas famílias não formam um grupo monofilético.

Chromosome Evolution in Dendropsophini (Amphibia, Anura, Hylinae)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Telomeres of polytene chromosomes in a ciliated protozoan terminate in duplex DNA loops

The end of a telomeric DNA sequence isolated from a polytene chromosome of a hypotrichous ciliate folds back and hybridizes with downstream telomeric sequence to form a t loop that is stable in the absence of protein and DNA cross-linking. The single-stranded, telomeric DNA sequence at the end of a macronuclear molecule does not form a t loop but, instead, is complexed with a heterodimeric, telomere-binding protein. Thus, two mechanisms for capping the ends of DNA molecules are used in the same cell.

DNA double-strand break repair proteins are required to cap the ends of mammalian chromosomes

Recent findings intriguingly place DNA double-strand break repair proteins at chromosome ends in yeast, where they help maintain normal telomere length and structure. In the present study, an essential telomere function, the ability to cap and thereby protect chromosomes from end-to-end fusions, was assessed in repair-deficient mouse cell lines. By using fluorescence in situ hybridization with a probe to telomeric DNA, spontaneously occurring chromosome aberrations were examined for telomere signal at the points of fusion, a clear indication of impaired end-capping. Telomeric fusions were not observed in any of the repair-proficient controls and occurred only rarely in a p53 null mutant. In striking contrast, chromosomal end fusions that retained telomeric sequence were observed in nontransformed DNA-PKcs-deficient cells, where they were a major source of chromosomal instability. Metacentric chromosomes created by telomeric fusion became even more abundant in these cells after spontaneous immortalization. Restoration of repair proficiency through transfection with a functional cDNA copy of the human DNA-PKcs gene reduced the number of fusions compared with a negative transfection control. Virally transformed cells derived from Ku70 and Ku80 knockout mice also displayed end-to-end fusions. These studies demonstrate that DNA double-strand break repair genes play a dual role in maintaining chromosomal stability in mammalian cells, the known role in repairing incidental DNA damage, as well as a new protective role in telomeric end-capping.

Telomerase inhibitors based on quadruplex ligands selected by a fluorescence assay

The reactivation of telomerase activity in most cancer cells supports the concept that telomerase is a relevant target in oncology, and telomerase inhibitors have been proposed as new potential anticancer agents. The telomeric G-rich single-stranded DNA can adopt in vitro an intramolecular quadruplex structure, which has been shown to inhibit telomerase activity. We used a fluorescence assay to identify molecules that stabilize G-quadruplexes. Intramolecular folding of an oligonucleotide with four repeats of the human telomeric sequence into a G-quadruplex structure led to fluorescence excitation energy transfer between a donor (fluorescein) and an acceptor (tetramethylrhodamine) covalently attached to the 5′ and 3′ ends of the oligonucleotide, respectively. The melting of the G-quadruplex was monitored in the presence of putative G-quadruplex-binding molecules by measuring the fluorescence emission of the donor. A series of compounds (pentacyclic crescent-shaped dibenzophenanthroline derivatives) was shown to increase the melting temperature of the G-quadruplex by 2–20°C at 1 μM dye concentration. This increase in Tm value was well correlated with an increase in the efficiency of telomerase inhibition in vitro. The best telomerase inhibitor showed an IC50 value of 28 nM in a standard telomerase repeat amplification protocol assay. Fluorescence energy transfer can thus be used to reveal the formation of four-stranded DNA structures, and its stabilization by quadruplex-binding agents, in an effort to discover new potent telomerase inhibitors.

Babesia bovis: Genome size, number of chromosomes and telomeric probe hybridisation

Pulsed field gel electrophoresis of intact chromosomes of Babesia bovis revealed four chromosomes in the haploid genome. A telomere probe, derived from Plasmodium berghei, hybridised to eight SfiI restriction fragments of genomic B. bovis DNA digests indicating the presence of four chromosomes. A small subunit (18S) ribosomal RNA gene probe hybridised to the third chromosome only. The genome size of B. bovis is estimated to be 9.4 million base pairs. The sizes of chromosomes 1, 2, 3 and 4 are estimated to be 1.4, 2.0, 2.8 and 3.2 million base pairs, respectively. (C) 1997 Australian Society for Parasitology. Published by Elsevier Science Ltd.

Charaterization of Leishmania major Friedlin Telomeric Terminus

Here we have characterized Leishmania major (Friedlin) telomeric terminus (the very end) using recombinants obtained by a vector-adaptor cloning protocol. As in L. donovani, the last nine nucleotides of L. major terminus are 5'-GGTTAGGGT-OH 3', differing from Trypanosoma cruzi and T. brucei terminus 5'GGGTTAGGG-OH 3', thus indicating that these sequences are genus specific. We have also made a comparative analysis between L. major and L. donovani telomere-associated sequences, and described a novel non-repeated telomeric associated sequence common to L. major low molecular weight chromosomal bands.

Evidence of chromosome fusion in Gymnotus sylvius Albert & Fernandes-Matoli, 1999 (Teleostei: Gymnotiformes) detected by telomeric probes and R-banding

Gymnotus cf. carapo and Gynznotus sylvius are two fish species inhabiting the Upper Parana River Basin, presenting respectively 2n =54 and 2n = 40 chromosomes. In the present cytogenetic analysis, R-banding and telomere-sequence hybridization were carried out in order to determine the possible relationship between the karyotipes of these two species. Incorporation bands (R-bands) obtained for the two species allowed the identification of chromosome similarities, showing to be an usefull alternative to the G-banding methods, which fail in producing satisfying results in most of analyzed fish species. This approach, associated with the hybridization of telomeric sequences, permited to identify chromosomal rearrangements that could be used as indicators of karyotypic evolution within the group. In the present case, telomeric sequences were detected in the centromeric region of two metacentric chromosome pairs of Gymnotus sylvius. The results obtained after hybridization with the telomere sequences, coupled with the chromosome homeologies detected by R-banding, showed that G. cf carapo and G. sylvius should present a common ancestor, and this may also be corroborated by the similarities found in three chromosome pairs, that seem to have been conserved during the evolution of the two species. Based on the data here presented we propose that G. sylvius may have undergone a recent process of chromosome fusion that resulted in the diminution of its chromosome number.