1000 resultados para Subjectivity Detection
Resumo:
En este trabajo se presenta un método para la detección de subjetividad a nivel de oraciones basado en la desambiguación subjetiva del sentido de las palabras. Para ello se extiende un método de desambiguación semántica basado en agrupamiento de sentidos para determinar cuándo las palabras dentro de la oración están siendo utilizadas de forma subjetiva u objetiva. En nuestra propuesta se utilizan recursos semánticos anotados con valores de polaridad y emociones para determinar cuándo un sentido de una palabra puede ser considerado subjetivo u objetivo. Se presenta un estudio experimental sobre la detección de subjetividad en oraciones, en el cual se consideran las colecciones del corpus MPQA y Movie Review Dataset, así como los recursos semánticos SentiWordNet, Micro-WNOp y WordNet-Affect. Los resultados obtenidos muestran que nuestra propuesta contribuye de manera significativa en la detección de subjetividad.
Resumo:
Recent years have witnessed a surge of interest in computational methods for affect, ranging from opinion mining, to subjectivity detection, to sentiment and emotion analysis. This article presents a brief overview of the latest trends in the field and describes the manner in which the articles contained in the special issue contribute to the advancement of the area. Finally, we comment on the current challenges and envisaged developments of the subjectivity and sentiment analysis fields, as well as their application to other Natural Language Processing tasks and related domains.
Resumo:
Automatic creation of polarity lexicons is a crucial issue to be solved in order to reduce time andefforts in the first steps of Sentiment Analysis. In this paper we present a methodology based onlinguistic cues that allows us to automatically discover, extract and label subjective adjectivesthat should be collected in a domain-based polarity lexicon. For this purpose, we designed abootstrapping algorithm that, from a small set of seed polar adjectives, is capable to iterativelyidentify, extract and annotate positive and negative adjectives. Additionally, the methodautomatically creates lists of highly subjective elements that change their prior polarity evenwithin the same domain. The algorithm proposed reached a precision of 97.5% for positiveadjectives and 71.4% for negative ones in the semantic orientation identification task.
Resumo:
Eradication of code smells is often pointed out as a way to improve readability, extensibility and design in existing software. However, code smell detection remains time consuming and error-prone, partly due to the inherent subjectivity of the detection processes presently available. In view of mitigating the subjectivity problem, this dissertation presents a tool that automates a technique for the detection and assessment of code smells in Java source code, developed as an Eclipse plugin. The technique is based upon a Binary Logistic Regression model that uses complexity metrics as independent variables and is calibrated by expert‟s knowledge. An overview of the technique is provided, the tool is described and validated by an example case study.
Resumo:
The soybean is important to the economy of Brazil, so the estimation of the planted area and the production with higher antecedence and reliability becomes essential. Techniques related to Remote Sensing may help to obtain this information at lower cost and less subjectivity in relation to traditional surveys. The aim of this study is to estimate the planted area with soybean culture in the crop of 2008/2009 in cities in the west of the state of Paraná, in Brazil, based on the spectral dynamics of the culture and through the use of the specific system of analysis for images of Landsat 5/TM satellite. The obtained results were satisfactory, because the classification supervised by Maximum Verisimilitude - MaxVer along with the techniques of the specific system of analysis for satellite images has allowed an estimate of soybean planted area (soybean mask), obtaining values of the metrics of Global Accuracy with an average of 79.05% and Kappa Index over 63.50% in all cities. The monitoring of a reference area was of great importance for determining the vegetative phase in which the culture is more different from the other targets, facilitating the choice of training samples (ROIs) and avoiding misclassifications.
Resumo:
The exponential growth of the subjective information in the framework of the Web 2.0 has led to the need to create Natural Language Processing tools able to analyse and process such data for multiple practical applications. They require training on specifically annotated corpora, whose level of detail must be fine enough to capture the phenomena involved. This paper presents EmotiBlog – a fine-grained annotation scheme for subjectivity. We show the manner in which it is built and demonstrate the benefits it brings to the systems using it for training, through the experiments we carried out on opinion mining and emotion detection. We employ corpora of different textual genres –a set of annotated reported speech extracted from news articles, the set of news titles annotated with polarity and emotion from the SemEval 2007 (Task 14) and ISEAR, a corpus of real-life self-expressed emotion. We also show how the model built from the EmotiBlog annotations can be enhanced with external resources. The results demonstrate that EmotiBlog, through its structure and annotation paradigm, offers high quality training data for systems dealing both with opinion mining, as well as emotion detection.
Resumo:
To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.
Resumo:
A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.
Resumo:
Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.
Resumo:
The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).
Resumo:
A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.
Resumo:
Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.
Resumo:
Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.