Permanent Magnet Hall Thruster for satellite orbit raising with low power energy consumption

Electric propulsion is now a succeful method for primary propulsion of deep space long duration missions and for geosyncronous satellite attitude control. Closed Drift Thruster, so called Hall Thruster or SPT (Stationary Plasma Thruster), was primarily conceived in USSR (the ancient Soviet Union) and, since then, it has been developed by space agencies, space research institutes and industries in several countries such as France, USA, Israel, Russian Federation and Brazil. In this work we present the main features of the Permanent Magnet Hall Thruster (PMHT) developed at the Plasma Laboratory of the University of Brasilia. The idea of using an array of permanent magnets, instead of an electromagnet, to produce a radial magnetic field inside the plasma channel of the thruster is very significant. It allows the development of a Hall Thruster with power consumption low enough to be used in small and medium size satellites. Description of a new vacuum chamber used to test the second prototype of the PMHT (PHALL II) will be given. PHALL II has an aluminum plasma chamber and is smaller with 15 cm diameter and will contain rare earth magnets. We will show plasma density and temperature space profiles inside and outside the thruster channel. Ion temperature measurements based on Doppler broadening of spectral lines and ion energy measurements are also shown. Based on the measured plasma parameters we constructed an aptitude figure of the PMHT. It contains the specific impulse, total thrust, propellant flow rate and power consumption necessary for orbit raising of satellites. Based on previous studies of geosyncronous satellite orbit positioning we perform numerical simulations of satellite orbit raising from an altitude of 700 km to 36000 km using a PMHT operating in the 100 mN - 500 mN thrust range. In order to perform these calculations integration techniques were used. The main simulation paraters were orbit raising time, fuel mass, total satellite mass, thrust and exaust velocity. We conclude comparing our results with results obtainned with known space missions performed with Hall Thrusters. © 2008 by the American Institute of Aeronautics and Astronautics, Inc.

Effect of segmented anodes on the performance and plume of a hall thruster

Development of alternative propellants for Hall thruster operation is an active area of research. Xenon is the current propellant of choice for Hall thrusters, but can be costly in large thrusters and for extended test periods. Condensible propellants may offer an alternative to xenon, as they will not require costly active pumping to remove from a test facility, and may be less expensive to purchase. A method has been developed which uses segmented electrodes in the discharge channel of a Hall thruster to divert discharge current to and from the main anode and thus control the anode temperature. By placing a propellant reservoir in the anode, the evaporation rate, and hence, mass flow of propellant can be controlled. Segmented electrodes for thermal control of a Hall thruster represent a unique strategy of thruster design, and thus the performance of the thruster must be measured to determine the effect the electrodes have on the thruster. Furthermore, the source of any changes in thruster performance due to the adjustment of discharge current between the shims and the main anode must be characterized. A Hall thruster was designed and constructed with segmented electrodes. It was then tested at anode voltages between 300 and 400 V and mass flows between 4 and 6 mg/s, as well as 100%, 75%, 50%, 25%, and <5% of the discharge current on the shim electrodes. The level of current on the shims was adjusted by changing the shim voltage. At each operating point, the thruster performance, plume divergence, ion energy, and multiply charged ion fraction were measured performance exhibited a small change with the level of discharge current on the shim electrodes. Thrust and specific impulse increased by as much as 6% and 7.7%, respectively, as discharge current was shifted from the main anode to the shims at constant anode voltage. Thruster efficiency did not change. Plume divergence was reduced by approximately 4 degrees of half-angle at high levels of current on the shims and at all combinations of mass flow and anode voltage. The fraction of singly charged xenon in the thruster plume varied between approximately 80% and 95% as the anode voltage and mass flow were changed, but did not show a significant change with shim current. Doubly and triply charged xenon made up the remainder of the ions detected. Ion energy exhibited a mixed behavior. The highest voltage present in the thruster largely dictated the most probable energy; either shim or anode voltage, depending on which was higher. The overall change in most probable ion energy was 20-30 eV, the majority of which took place while the shim voltage was higher than the anode voltage. The thrust, specific impulse, plume divergence, and ion energy all indicate that the thruster is capable of a higher performance output at high levels of discharge current on the shims. The lack of a change in efficiency and fraction of multiply charged ions indicate that the thruster can be operated at any level of current on the shims without detrimental effect, and thus a condensible propellant thruster can control the anode temperature without a decrease in efficiency or a change in the multiply charged ion fraction.

Development of a direct evaporation bismuth Hall thruster

Hall thrusters have been under active development around the world since the 1960’s. Thrusters using traditional propellants such as xenon have been flown on a variety of satellite orbit raising and maintenance missions with an excellent record. To expand the mission envelope, it is necessary to lower the specific impulse of the thrusters but xenon and krypton are poor performers at specific impulses below 1,200 seconds. To enhance low specific impulse performance, this dissertation examines the development of a Hall-effect thruster which uses bismuth as a propellant. Bismuth, the heaviest non-radioactive element, holds many advantages over noble gas propellants from an energetics as well as a practical economic standpoint. Low ionization energy, large electron-impact crosssection and high atomic mass make bismuth ideal for low-specific impulse applications. The primary disadvantage lies in the high temperatures which are required to generate the bismuth vapors. Previous efforts carried out in the Soviet Union relied upon the complete bismuth vaporization and gas phase delivery to the anode. While this proved successful, the power required to vaporize and maintain gas phase throughout the mass flow system quickly removed many of the efficiency gains expected from using bismuth. To solve these problems, a unique method of delivering liquid bismuth to the anode has been developed. Bismuth is contained within a hollow anode reservoir that is capped by a porous metallic disc. By utilizing the inherent waste heat generated in a Hall thruster, liquid bismuth is evaporated and the vapors pass through the porous disc into the discharge chamber. Due to the high temperatures and material compatibility requirements, the anode was fabricated out of pure molybdenum. The porous vaporizer was not available commercially so a method of creating a refractory porous plate with 40-50% open porosity was developed. Molybdenum also does not respond well to most forms of welding so a diffusion bonding process was also developed to join the molybdenum porous disc to the molybdenum anode. Operation of the direct evaporation bismuth Hall thruster revealed interesting phenomenon. By utilizing constant current mode on a discharge power supply, the discharge voltage settles out to a stable operating point which is a function of discharge current, anode face area and average pore size on the vaporizer. Oscillations with a 40 second period were also observed. Preliminary performance data suggests that the direct evaporation bismuth Hall thruster performs similar to xenon and krypton Hall thrusters. Plume interrogation with a Retarding Potential Analyzer confirmed that bismuth ions were being efficiently accelerated while Faraday probe data gave a view of the ion density in the exhausted plume.

Laser Thomson scattering measurements of electron temperature and density in a Hall-effect plasma

Hall-effect thrusters (HETs) are compact electric propulsion devices with high specific impulse used for a variety of space propulsion applications. HET technology is well developed but the electron properties in the discharge are not completely understood, mainly due to the difficulty involved in performing accurate measurements in the discharge. Measurements of electron temperature and density have been performed using electrostatic probes, but presence of the probes can significantly disrupt thruster operation, and thus alter the electron temperature and density. While fast-probe studies have expanded understanding of HET discharges, a non-invasive method of measuring the electron temperature and density in the plasma is highly desirable. An alternative to electrostatic probes is a non-perturbing laser diagnostic technique that measures Thomson scattering from the plasma. Thomson scattering is the process by which photons are elastically scattered from the free electrons in a plasma. Since the electrons have thermal energy their motion causes a Doppler shift in the scattered photons that is proportional to their velocity. Like electrostatic probes, laser Thomson scattering (LTS) can be used to determine the temperature and density of free electrons in the plasma. Since Thomson scattering measures the electron velocity distribution function directly no assumptions of the plasma conditions are required, allowing accurate measurements in anisotropic and non-Maxwellian plasmas. LTS requires a complicated measurement apparatus, but has the potential to provide accurate, non-perturbing measurements of electron temperature and density in HET discharges. In order to assess the feasibility of LTS diagnostics on HETs non-invasive measurements of electron temperature and density in the near-field plume of a Hall thruster were performed using a custom built laser Thomson scattering diagnostic. Laser measurements were processed using a maximum likelihood estimation method and results were compared to conventional electrostatic double probe measurements performed at the same thruster conditions. Electron temperature was found to range from approximately 1 – 40 eV and density ranged from approximately 1.0 x 1017 m-3 to 1.3 x 1018 m-3 over discharge voltages from 250 to 450 V and mass flow rates of 40 to 80 SCCM using xenon propellant.

EVALUATION OF MAGNESIUM AS A HALL THRUSTER PROPELLANT

In this study, the use of magnesium as a Hall thruster propellant was evaluated. A xenon Hall thruster was modified such that magnesium propellant could be loaded into the anode and use waste heat from the thruster discharge to drive the propellant vaporization. A control scheme was developed, which allowed for precise control of the mass flow rate while still using plasma heating as the main mechanism for evaporation. The thruster anode, which also served as the propellant reservoir, was designed such that the open area was too low for sufficient vapor flow at normal operating temperatures (i.e. plasma heating alone). The remaining heat needed to achieve enough vapor flow to sustain thruster discharge came from a counter-wound resistive heater located behind the anode. The control system has the ability to arrest thermal runaway in a direct evaporation feed system and stabilize the discharge current during voltage-limited operation. A proportional-integral-derivative control algorithm was implemented to enable automated operation of the mass flow control system using the discharge current as the measured variable and the anode heater current as the controlled parameter. Steady-state operation at constant voltage with discharge current excursions less than 0.35 A was demonstrated for 70 min. Using this long-duration method, stable operation was achieved with heater powers as low as 6% of the total discharge power. Using the thermal mass flow control system the thruster operated stably enough and long enough that performance measurements could be obtained and compared to the performance of the thruster using xenon propellant. It was found that when operated with magnesium, the thruster has thrust ranging from 34 mN at 200 V to 39 mN at 300 V with 1.7 mg/s of propellant. It was found to have 27 mN of thrust at 300 V using 1.0 mg/s of propellant. The thrust-to-power ratio ranged from 24 mN/kW at 200 V to 18 mN/kW at 300 volts. The specific impulse was 2000 s at 200 V and upwards of 2700 s at 300 V. The anode efficiency was found to be ~23% using magnesium, which is substantially lower than the 40% anode efficiency of xenon at approximately equivalent molar flow rates. Measurements in the plasma plume of the thruster—operated using magnesium and xenon propellants—were obtained using a Faraday probe to measure off-axis current distribution, a retarding potential analyzer to measure ion energy, and a double Langmuir probe to measure plasma density, electron temperature, and plasma potential. Additionally, the off axis current distributions and ion energy distributions were compared to measurements made in krypton and bismuth plasmas obtained in previous studies of the same thruster. Comparisons showed that magnesium had the largest beam divergence of the four propellants while the others had similar divergence. The comparisons also showed that magnesium and krypton both had very low voltage utilization compared to xenon and bismuth. It is likely that the differences in plume structure are due to the atomic differences between the propellants; the ionization mean free path goes down with increasing atomic mass. Magnesium and krypton have long ionization mean free paths and therefore require physically larger thruster dimensions for efficient thruster operation and would benefit from magnetic shielding.

Numerical Model of a Variable-Combined-Cycle Engine for Dual Subsonic and Supersonic Cruise

Efficient high speed propulsion requires exploiting the cooling capability of the cryogenic fuel in the propulsion cycle. This paper presents the numerical model of a combined cycle engine while in air turbo-rocket configuration. Specific models of the various heat exchanger modules and the turbomachinery elements were developed to represent the physical behavior at off-design operation. The dynamic nature of the model allows the introduction of the engine control logic that limits the operation of certain subcomponents and extends the overall engine operational envelope. The specific impulse and uninstalled thrust are detailed while flying a determined trajectory between Mach 2.5 and 5 for varying throttling levels throughout the operational envelope.

Control of hypersonic turbulent skin friction by boundary-layer combustion of hydrogen

Shvab-Zeldovich coupling of flow variables has been used to extend Van Driest's theory of turbulent boundary-layer skin friction to include injection and combustion of hydrogen in the boundary layer. The resulting theory is used to make predictions of skin friction and heat transfer that are found to be consistent with experimental and numerical results. Using the theory to extrapolate to larger downstream distances at the same experimental conditions, it is found that the reduction in skin-friction drag with hydrogen mixing and combustion is three times that with mixing alone. In application to flow on a flat plate at mainstream velocities of 2, 4, and 6 knits, and Reynolds numbers from 3 X 10(6) to 1 x 10(8), injection and combustion of hydrogen yielded values of skin-friction drag that were less than one-half of the no-injection skin-friction drag, together with a net reduction in heat transfer when the combustion heat release in air was less than the stagnation enthalpy. The mass efficiency of hydrogen injection, as measured by effective specific impulse values, was approximately 2000 s.

Performance of a scramjet combustor with combined normal and tangential fuel injection

The performance of a scramjet combustor with combined normal and tangential injection was experimentally investigated. Experiments were performed on a 500-mm cylindrical scramjet combustor at a freestream Mach number of 4.5, a nozzle supply pressure of 35.8 MPa, and a nozzle supply enthalpy of 5.8 MJ/kg. Hydrogen fuel was injected normally through portholes to promote combustion and tangentially through a slot to reduce viscous drag. A series of fuel injectors were used to vary the proportion of tangential to normal fuel between 45 and 100%. Reductions in the viscous drag of up to 25% were observed with the greatest reductions occurring at the lowest total equivalence ratio tested for each injector. However, the average pressure produced by combustion with combined normal and tangential injection was approximately 50% less than that produced by normal injection alone. An analysis of the change in specific impulse of the scramjet combustor indicated that the best overall performance was produced by 100% normal injection.

Development of iodine and air chemistry models for the simulation of plasma in Helicon Plasma Thrusters

The aim of this work is to analyse the chemistry models of low pressure Helicon discharges fed with iodine and air. In particular the focus of this research is to understand the plasma dynamics in order to predict propulsive performances of iodine and air-breathing Helicon Plasma Thrusters. The two systems have been simulated and analysed with the use of global models, i.e. a 0 dimensional tool to solve the set of governing equations by assuming that all quantities are volume averaged. Furthermore, some strategies have been implemented to improve the accuracy of this approach. A verification have been accomplished on the global models for both iodine and air, comparing results against simulations taken from literature. Moreover, the iodine global model has been validated against the experimental measurements of REGULUS, an helicon plasma thruster developed by the Italian company T4i, with a good agreement. From the analysis of iodine model, it has been found a significantly higher density for atomic positive ions with respect to molecular ions. Negative ions, instead, have shown to have negligible effect on the propulsive results. Also, the influence of reactions between heavy particles has been analysed with the global model. Results have demonstrated that, in the iodine case, chemistry is almost entirely affected by electronic collisions. For what concerns air-breathing results, it has been investigated the effects of the orbital height on propulsive performances. In particular, the global model has shown that at lower height, the values of thrust and specific impulse are lower due a change in atmosphere concentration. Finally, the iodine chemistry model has been introduced in the fluid code 3D-VIRTUS in order to preliminary assess the plasma properties of a Helicon discharge chamber for electric propulsion.

Acoustic radiation force impulse (ARFI) elastography of the spleen in healthy adult cats - a preliminary study

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Acting on impulse: using the neuroscience of impulse control to improve the law

This thesis investigates the potential legal utility of neurotechnologies which measure correlates of impulsive behaviors. Chapter 1 explains my philosophical position and how this position compares to others in the field. Chapter 2 explores some of the technical concepts which must be understood for the discussion of neurotechnologies and their applications to be fruitful. These chapters will be important for both explaining the capabilities of a neuroscientific approach to neural abnormalities as well as how they relate to the kind of regulation in which the law is engaged. The purpose of Chapter 3 will be a descriptive account of Canadian law where I will begin to explore how to apply ideas and experiments from neuroscience to specific areas of law. Chapter 3 will look at actual examples of Canadian criminal law and will span topics from the creation of law to the construction of appropriate sentences. Chapter 4 will debate if and how we should apply the neuroscientific perspective to the law given the ethical concerns surrounding the applications described in Chapter 3. The thrust of the chapter is that the development of the law does not occur in a vacuum and any alteration either to the laws themselves, how they are interpreted, or the technologies used to provide evidence, must have an ethical justification, that is, a way in which the proposed change will better meet the needs of society and the ethical objectives of the law. Sometimes these justifications can be drawn directly from constitutional documents, such as the Charter, or from the Criminal Code, while at other times these justifications depend upon arguments about furthering meaningful responsibility and therapeutic outcomes.

Site Specific Spin Dynamics In Bafe2as2: Tuning The Ground State By Orbital Differentiation.

The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.

Survival Extrapolation In The Presence Of Cause Specific Hazards.

Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.

Post Hoc Analysis Of The Patricia Randomized Trial Of The Efficacy Of Human Papillomavirus Type 16 (hpv-16)/hpv-18 As04-adjuvanted Vaccine Against Incident And Persistent Infection With Nonvaccine Oncogenic Hpv Types Using An Alternative Multiplex Type-specific Pcr Assay For Hpv Dna.

The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.