999 resultados para Specific bindings
Resumo:
Vip3Aa, Vip3Af, Cry1Ab, and Cry1Fa were tested for their toxicities and binding interactions. Vip3A proteins were more toxic than Cry1 proteins. Binding assays showed independent specific binding sites for Cry1 and Vip3A proteins. Cry1Ab and Cry1Fa competed for the same binding sites, whereas Vip3Aa competed for those of Vip3Af. Copyright © 2009, American Society for Microbiology. All Rights Reserved.
Resumo:
Heme-binding protein 23 kDa (HBP23), a rat isoform of human proliferation-associated gene product (PAG), is a member of the peroxiredoxin family of peroxidases, having two conserved cysteine residues. Recent biochemical studies have shown that HBP23/PAG is an oxidative stress-induced and proliferation-coupled multifunctional protein that exhibits specific bindings to c-Abl protein tyrosine kinase and heme, as well as a peroxidase activity. A 2.6-Å resolution crystal structure of rat HBP23 in oxidized form revealed an unusual dimer structure in which the active residue Cys-52 forms a disulfide bond with conserved Cys-173 from another subunit by C-terminal tail swapping. The active site is largely hydrophobic with partially exposed Cys-173, suggesting a reduction mechanism of oxidized HBP23 by thioredoxin. Thus, the unusual cysteine disulfide bond is involved in peroxidation catalysis by using thioredoxin as the source of reducing equivalents. The structure also provides a clue to possible interaction surfaces for c-Abl and heme. Several significant structural differences have been found from a 1-Cys peroxiredoxin, ORF6, which lacks the C-terminal conserved cysteine corresponding to Cys-173 of HBP23.
Resumo:
The role of orbital differentiation on the emergence of superconductivity in the Fe-based superconductors remains an open question to the scientific community. In this investigation, we employ a suitable microscopic spin probe technique, namely Electron Spin Resonance (ESR), to investigate this issue on selected chemically substituted BaFe2As2 single crystals. As the spin-density wave (SDW) phase is suppressed, we observe a clear increase of the Fe 3d bands anisotropy along with their localization at the FeAs plane. Such an increase of the planar orbital content is interestingly independent of the chemical substitution responsible for suppressing the SDW phase. As a consequence, the magnetic fluctuations in combination with this particular symmetry of the Fe 3d bands are propitious ingredients for the emergence of superconductivity in this class of materials.
Resumo:
Health economic evaluations require estimates of expected survival from patients receiving different interventions, often over a lifetime. However, data on the patients of interest are typically only available for a much shorter follow-up time, from randomised trials or cohorts. Previous work showed how to use general population mortality to improve extrapolations of the short-term data, assuming a constant additive or multiplicative effect on the hazards for all-cause mortality for study patients relative to the general population. A more plausible assumption may be a constant effect on the hazard for the specific cause of death targeted by the treatments. To address this problem, we use independent parametric survival models for cause-specific mortality among the general population. Because causes of death are unobserved for the patients of interest, a polyhazard model is used to express their all-cause mortality as a sum of latent cause-specific hazards. Assuming proportional cause-specific hazards between the general and study populations then allows us to extrapolate mortality of the patients of interest to the long term. A Bayesian framework is used to jointly model all sources of data. By simulation, we show that ignoring cause-specific hazards leads to biased estimates of mean survival when the proportion of deaths due to the cause of interest changes through time. The methods are applied to an evaluation of implantable cardioverter defibrillators for the prevention of sudden cardiac death among patients with cardiac arrhythmia. After accounting for cause-specific mortality, substantial differences are seen in estimates of life years gained from implantable cardioverter defibrillators.
Resumo:
The efficacy of the human papillomavirus type 16 (HPV-16)/HPV-18 AS04-adjuvanted vaccine against cervical infections with HPV in the Papilloma Trial against Cancer in Young Adults (PATRICIA) was evaluated using a combination of the broad-spectrum L1-based SPF10 PCR-DNA enzyme immunoassay (DEIA)/line probe assay (LiPA25) system with type-specific PCRs for HPV-16 and -18. Broad-spectrum PCR assays may underestimate the presence of HPV genotypes present at relatively low concentrations in multiple infections, due to competition between genotypes. Therefore, samples were retrospectively reanalyzed using a testing algorithm incorporating the SPF10 PCR-DEIA/LiPA25 plus a novel E6-based multiplex type-specific PCR and reverse hybridization assay (MPTS12 RHA), which permits detection of a panel of nine oncogenic HPV genotypes (types 16, 18, 31, 33, 35, 45, 52, 58, and 59). For the vaccine against HPV types 16 and 18, there was no major impact on estimates of vaccine efficacy (VE) for incident or 6-month or 12-month persistent infections when the MPTS12 RHA was included in the testing algorithm versus estimates with the protocol-specified algorithm. However, the alternative testing algorithm showed greater sensitivity than the protocol-specified algorithm for detection of some nonvaccine oncogenic HPV types. More cases were gained in the control group than in the vaccine group, leading to higher point estimates of VE for 6-month and 12-month persistent infections for the nonvaccine oncogenic types included in the MPTS12 RHA assay (types 31, 33, 35, 45, 52, 58, and 59). This post hoc analysis indicates that the per-protocol testing algorithm used in PATRICIA underestimated the VE against some nonvaccine oncogenic HPV types and that the choice of the HPV DNA testing methodology is important for the evaluation of VE in clinical trials. (This study has been registered at ClinicalTrials.gov under registration no. NCT00122681.).
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Nocardia is a rare opportunistic agent, which may affect immunocompromised individuals causing lung infections and exceptionally infective endocarditis (IE). There are few reports of IE caused by Nocardia sp., usually involving biological prostheses but rarely in natural valves. Its accurate microbiological identification may be hampered by the similarity with Rhodococcus equi and Corynebacterium spp. Here we report a case of native mitral valve IE caused by this agent in which the clinical absence of response to vancomycin and the suggestion of Nocardia sp. by histology pointed to the misdiagnosis of Corynebacterium spp. in blood cultures. The histological morphology can advise on the need for expansion of cultivation time and use of extra microbiological procedures that lead to the differential diagnosis with Corynebacterium spp. and other agents, which is essential to establish timely specific treatment, especially in immunocompromised patients.
Resumo:
With a view toward investigating the feeding behavior of Culicidae mosquitoes from an area of epizootic yellow fever transmission in the municipalities of Garruchos and Santo Antônio das Missões, Rio Grande do Sul State, Brazil, specimens were collected by aspiration from September 2005 to April 2007. The engorged females were submitted to blood meal identification by enzyme-linked immunosorbent assay (ELISA). A total of 142 blood-engorged samples were examined for human or monkey blood through species-specific IgG. Additional tests for specificity utilizing isotypes IgG1 and IgG4 of human monoclonal antibodies showed that only anti-human IgG1 was effective in recognizing blood meals of human origin. The results indicated a significant difference (p = 0.027) in detection patterns in samples of Haemagogus leucocelaenus recorded from human blood meals at Santo Antônio das Missões, which suggests some degree of exposure, since it was an area where epizootic outbreaks have been reported.
Resumo:
Feline Immunodeficiency Virus is a worldwide infection and is considered a significant pathogen. The diagnosis of FIV infections is mainly based on commercially available rapid tests that are highly expensive in Brazil, hence it is rarely performed in the country. Furthermore, lentiviruses grow slowly and poorly in tissue cultures, making the production of viral antigen by classic means and thus the establishment of FIV immunodiagnosis impracticable. In order to deal with this, recombinant DNA techniques were adopted to produce the protein p24, a viral capsid antigen. The protein's reactivity evaluation analyzed by Western blot indicated that this recombinant antigen can be a useful tool for the immunodiagnostic of FIV infections.
Resumo:
While a queen control pheromone complex that inhibits worker ovary development has been described for honey bees, no comparable control pheromones have been identified for their sister group, the stingless bees. The aim of the present work was to search for possible control pheromones in the stingless bee Friesella schrottkyi. No volatile substances were found in the heads of queens that might serve as queen control pheromones. On the other hand, distinct differences were found between the cuticular substances of queens and workers. The major hydrocarbons were different between the two castes, and while queens contained methyl-branched alkanes and no unsaturated hydrocarbons, workers contained alkenes and alka-dienes but no methyl branched hydrocarbons. Colonies deprived of a queen produced laying workers. Differences were observed in the cuticular patterns of laying workers and workers from a queen controlled colony.
Resumo:
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) plays an important role in the life cycle of the Trypanosoma cruzi, and an immobilized enzyme reactor (IMER) has been developed for use in the on-line screening for GAPDH inhibitors. An IMER containing human GAPDH has been previously reported; however, these conditions produced a T. cruzi GAPDH-IMER with poor activity and stability. The factors affecting the stability of the human and T. cruzi GAPDHs in the immobilization process and the influence of pH and buffer type on the stability and activity of the IMERs have been investigated. The resulting T. cruzi GAPDH-IMER was coupled to an analytical octyl column, which was used to achieve chromatographic separation of NAD+ from NADH. The production of NADH stimulated by D-glyceraldehyde-3-phosphate was used to investigate the activity and kinetic parameters of the immobilized T. cruzi GAPDH. The Michaelis-Menten constant (K-m) values determined for D-glyceraldehyde-3-phosphate and NAD(+) were K-m = 0.5 +/- 0.05 mM and 0.648 +/- 0.08 mM, respectively, which were consistent with the values obtained using the non-immobilized enzyme.
Resumo:
Background: Prostate cancer cells in primary tumors have been typed CD10(-)/CD13(-)/CD24(hi)/CD26(+)/CD38(lo)/CD44(-)/CD104(-). This CD phenotype suggests a lineage relationship between cancer cells and luminal cells. The Gleason grade of tumors is a descriptive of tumor glandular differentiation. Higher Gleason scores are associated with treatment failure. Methods: CD26(+) cancer cells were isolated from Gleason 3+3 (G3) and Gleason 4+4 (G4) tumors by cell sorting, and their gene expression or transcriptome was determined by Affymetrix DNA array analysis. Dataset analysis was used to determine gene expression similarities and differences between G3 and G4 as well as to prostate cancer cell lines and histologically normal prostate luminal cells. Results: The G3 and G4 transcriptomes were compared to those of prostatic cell types of non-cancer, which included luminal, basal, stromal fibromuscular, and endothelial. A principal components analysis of the various transcriptome datasets indicated a closer relationship between luminal and G3 than luminal and G4. Dataset comparison also showed that the cancer transcriptomes differed substantially from those of prostate cancer cell lines. Conclusions: Genes differentially expressed in cancer are potential biomarkers for cancer detection, and those differentially expressed between G3 and G4 are potential biomarkers for disease stratification given that G4 cancer is associated with poor outcomes. Differentially expressed genes likely contribute to the prostate cancer phenotype and constitute the signatures of these particular cancer cell types.
Resumo:
Background: The prostate stroma is a key mediator of epithelial differentiation and development, and potentially plays a role in the initiation and progression of prostate cancer. The tumor-associated stroma is marked by increased expression of CD90/THYI. Isolation and characterization of these stromal cells could provide valuable insight into the biology of the tumor microenvironment. Methods: Prostate CD90(+) stromal fibromuscular cells from tumor specimens were isolated by cell-sorting and analyzed by DNA microarray. Dataset analysis was used to compare gene expression between histologically normal and tumor-associated stromal cells. For comparison, stromal cells were also isolated and analyzed from the urinary bladder. Results: The tumor-associated stromal cells were found to have decreased expression of genes involved in smooth muscle differentiation, and those detected in prostate but not bladder. Other differential expression between the stromal cell types included that of the CXC-chemokine genes. Conclusion: CD90(+) prostate tumor-associated stromal cells differed from their normal counterpart in expression of multiple genes, some of which are potentially involved in organ development.
Resumo:
The T cell immunoglobulin mucin 3 (Tim-3) receptor is highly expressed on HIV-1-specific T cells, rendering them partially ""exhausted'' and unable to contribute to the effective immune mediated control of viral replication. To elucidate novel mechanisms contributing to the HTLV-1 neurological complex and its classic neurological presentation called HAM/TSP (HTLV-1 associated myelopathy/tropical spastic paraparesis), we investigated the expression of the Tim-3 receptor on CD8(+) T cells from a cohort of HTLV-1 seropositive asymptomatic and symptomatic patients. Patients diagnosed with HAM/TSP down-regulated Tim-3 expression on both CD8(+) and CD4(+) T cells compared to asymptomatic patients and HTLV-1 seronegative controls. HTLV-1 Tax-specific, HLA-A*02 restricted CD8(+) T cells among HAM/TSP individuals expressed markedly lower levels of Tim-3. We observed Tax expressing cells in both Tim-3(+) and Tim-3(-) fractions. Taken together, these data indicate that there is a systematic downregulation of Tim-3 levels on T cells in HTLV-1 infection, sustaining a profoundly highly active population of potentially pathogenic T cells that may allow for the development of HTLV-1 complications.
Resumo:
Background: Celery (Apium graveolens) represents a relevant allergen source that can elicit severe reactions in the adult population. To investigate the sensitization prevalence and cross-reactivity of Api g 2 from celery stalks in a Mediterranean population and in a mouse model. Methodology: 786 non-randomized subjects from Italy were screened for IgE reactivity to rApi g 2, rArt v 3 (mugwort pollen LTP) and nPru p 3 (peach LTP) using an allergen microarray. Clinical data of 32 selected patients with reactivity to LTP under investigation were evaluated. Specific IgE titers and cross-inhibitions were performed in ELISA and allergen microarray. Balb/c mice were immunized with purified LTPs; IgG titers were determined in ELISA and mediator release was examined using RBL-2H3 cells. Simulated endolysosomal digestion was performed using microsomes obtained from human DCs. Results: IgE testing showed a sensitization prevalence of 25.6% to Api g 2, 18.6% to Art v 3, and 28.6% to Pru p 3 and frequent co-sensitization and correlating IgE-reactivity was observed. 10/32 patients suffering from LTP-related allergy reported symptoms upon consumption of celery stalks which mainly presented as OAS. Considerable IgE cross-reactivity was observed between Api g 2, Art v 3, and Pru p 3 with varying inhibition degrees of individual patients' sera. Simulating LTP mono-sensitization in a mouse model showed development of more congruent antibody specificities between Api g 2 and Art v 3. Notably, biologically relevant murine IgE cross-reactivity was restricted to the latter and diverse from Pru p 3 epitopes. Endolysosomal processing of LTP showed generation of similar clusters, which presumably represent T-cell peptides. Conclusions: Api g 2 represents a relevant celery stalk allergen in the LTP-sensitized population. The molecule displays common B cell epitopes and endolysosomal peptides that encompass T cell epitopes with pollen and plant-food derived LTP.