Longitudinal and logistic analysis of endocrine hormone profiles, physical maturation, and candidate genes related to pubertal events in children

Children who experience early pubertal development have an increased risk of developing cancer (breast, ovarian, and testicular), osteoporosis, insulin resistance, and obesity as adults. Early pubertal development has been associated with depression, aggressiveness, and increased sexual prowess. Possible explanations for the decline in age of pubertal onset include genetics, exposure to environmental toxins, better nutrition, and a reduction in childhood infections. In this study we (1) evaluated the association between 415 single nucleotide polymorphisms (SNPs) from hormonal pathways and early puberty, defined as menarche prior to age 12 in females and Tanner Stage 2 development prior to age 11 in males, and (2) measured endocrine hormone trajectories (estradiol, testosterone, and DHEAS) in relation to age, race, and Tanner Stage in a cohort of children from Project HeartBeat! At the end of the 4-year study, 193 females had onset of menarche and 121 males had pubertal staging at age 11. African American females had a younger mean age at menarche than Non-Hispanic White females. African American females and males had a lower mean age at each pubertal stage (1-5) than Non-Hispanic White females and males. African American females had higher mean BMI measures at each pubertal stage than Non-Hispanic White females. Of the 415 SNPs evaluated in females, 22 SNPs were associated with early menarche, when adjusted for race ( p<0.05), but none remained significant after adjusting for multiple testing by False Discovery Rate (p<0.00017). In males, 17 SNPs were associated with early pubertal development when adjusted for race (p<0.05), but none remained significant when adjusted for multiple testing (p<0.00017). ^ There were 4955 hormone measurements taken during the 4-year study period from 632 African American and Non-Hispanic White males and females. On average, African American females started and ended the pubertal process at a younger age than Non-Hispanic White females. The mean age of Tanner Stage 2 breast development in African American and Non-Hispanic White females was 9.7 (S.D.=0.8) and 10.2 (S.D.=1.1) years, respectively. There was a significant difference by race in mean age for each pubertal stage, except Tanner Stage 1 for pubic hair development. Both Estradiol and DHEAS levels in females varied significantly with age, but not by race. Estradiol and DHEAS levels increased from Tanner Stage 1 to Tanner Stage 5.^ African American males had a lower mean age at each Tanner Stage of development than Non-Hispanic White males. The mean age of Tanner Stage 2 genital development in African American and Non-Hispanic White males was 10.5 (S.D.=1.1) and 10.8 (S.D.=1.1) years, respectively, but this difference was not significant (p=0.11). Testosterone levels varied significantly with age and race. Non-Hispanic White males had higher levels of testosterone than African American males from Tanner Stage 1-4. Testosterone levels increased for both races from Tanner Stage 1 to Tanner Stage 5. Testosterone levels had the steepest increase from ages 11-15 for both races. DHEAS levels in males varied significantly with age, but not by race. DHEAS levels had the steepest increase from ages 14-17. ^ In conclusion, African American males and females experience pubertal onset at a younger age than Non-Hispanic White males and females, but in this study, we could not find a specific gene that explained the observed variation in age of pubertal onset. Future studies with larger study populations may provide a better understanding of the contribution of genes in early pubertal onset.^

Bone mineral density in healthy female adolescents according to age, bone age and pubertal breast stage

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Consultation for Disordered Puberty: What Do Adolescent Medicine Patients Teach Us?

The period of adolescence is not only marked by important growth and pubertal events, but is also characterized by important psychosocial changes driven by a search for autonomy and the construction of one's identity. It can thus be easily understood that puberty disorders interfere heavily with these process, requiring from the endocrinologist not only medical knowledge, but also a great deal of emotional and psychological skills. They must progressively move from an educational approach that heavily involves the parents to one of shared information and decision making that places the young patient at the center of the therapeutic process. This can be achieved in several ways: respecting the affective and cognitive development of the adolescent; securing his privacy and (if requested by him) confidentiality; exploring his self-image and self-esteem and adapting the therapeutic process to the patient's expectations; reviewing the teenager's lifestyle, including the issue of sexuality and sexual behavior, and involving him in any therapeutic choice that has to be made, even if it does not match with the parents' expectations. The skills required for this respectful and holistic follow-up often exceed the abilities of any physician; it is thus suggested that a team approach involving a clinical nurse and/or a psychologist and/or social worker(s) be set up whenever possible.

Bone mineralization in Brazilian adolescents: The years of maximum bone mass incorporation

Puberty is the fundamental period for bone mass (BM) acquisition. In this period mineralization is found to increase with levels of high bone formation. The critical years of intense bone anabolism deserve special attention, as adequate gain could minimize fracture risk in later years. The objective of this work was to study bone mineral content (BMC) and bone mineral density (BMD) in male adolescents with age bracket and maturation level. Sixty-one healthy male 10 to 19 year-olds were evaluated for calcium intake, weight, stature, BMI, puberty stage and BMC and BMD in the lumbar spine and femur. BM was measured by bone densitometry (DXA). Calcium intake was calculated by recording 3 days diet. Puberty stage was defined as per Tanner. Descriptive statistics was used with means and standard deviations, linear correlation, and analysis of variance for comparison between age groups, and the Tukey test (p<0.05). Linear correlation was positive and indicated body weight as the main correlation variable with BMD in both studied locations (p<0.01). BMC and BMD increased with age, differences were significant from 14 to 15 years, and when adolescents reached Tanner stage G4. These results showed a pronounced increase in bone mineralization, with the years after 14 to 15 being critical for BM acquisition in Brazilian adolescents.

Densidade mineral óssea de adolescentes saudáveis do sexo feminino

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Follicle profile and plasma gonadotropin concentration in pubertal female ponies

Twelve female ponies were examined daily for 30 days and classified as ovulating (OV; N = 6; 197 ± 6 kg) or prepubertal (PP; N = 6; 196 ± 9 kg). Follicles were detected by ultrasound and gonadotropins quantified by radioimmunoassay. The mean diameter of the largest follicles was significantly larger in OV (38 ± 1 mm) than in PP (26 ± 2 mm) but there was no difference between groups in the size of the second largest follicle. There were more small follicles (<24 mm) in the PP than in the OV group, but PP fillies had a smaller number of follicles >29 mm than the OV fillies. Follicle-stimulating hormone (FSH) levels did not differ between groups but PP fillies had lower luteinizing hormone (LH) peak (8 ± 1 ng/ml) and basal (4 ± 0.5 ng/ml) levels, lower peak magnitude (2 ± 0.2 ng/ml) and period average (5 ± 0.6 ng/ml) than OV fillies (32 ± 4.5, 8 ± 1.2, 17.1 ± 6, and 15 ± 2.3 ng/ml, respectively). The PP group, in contrast to the OV group, showed no relationship between FSH surge and follicle wave emergence. We conclude that an LH concentration higher than 8 ng/ml is needed for follicle growth to a preovulatory size. Wave emergence and FSH secretion seem to be independent events, probably due to an inhibitory neural system in these PP animals. PP fillies may provide a physiological model for the study of follicle wave emergence which apparently does not depend on gonadotropin levels.

Follicle profile and plasma gonadotropin concentration in pubertal female ponies

Twelve female ponies were examined daily for 30 days and classified as ovulating (OV; N = 6; 197 ± 6 kg) or prepubertal (PP; N = 6; 196 ± 9 kg). Follicles were detected by ultrasound and gonadotropins quantified by radioimmunoassay. The mean diameter of the largest follicles was significantly larger in OV (38 ± 1 mm) than in PP (26 ± 2 mm) but there was no difference between groups in the size of the second largest follicle. There were more small follicles (<24 mm) in the PP than in the OV group, but PP fillies had a smaller number of follicles >29 mm than the OV fillies. Follicle-stimulating hormone (FSH) levels did not differ between groups but PP fillies had lower luteinizing hormone (LH) peak (8 ± 1 ng/ml) and basal (4 ± 0.5 ng/ml) levels, lower peak magnitude (2 ± 0.2 ng/ml) and period average (5 ± 0.6 ng/ml) than OV fillies (32 ± 4.5, 8 ± 1.2, 17.1 ± 6, and 15 ± 2.3 ng/ml, respectively). The PP group, in contrast to the OV group, showed no relationship between FSH surge and follicle wave emergence. We conclude that an LH concentration higher than 8 ng/ml is needed for follicle growth to a preovulatory size. Wave emergence and FSH secretion seem to be independent events, probably due to an inhibitory neural system in these PP animals. PP fillies may provide a physiological model for the study of follicle wave emergence which apparently does not depend on gonadotropin levels.

Two periods of total testicular regression are peculiar events of the annual reproductive cycle of the black Myotis bat, Myotis nigricans (Chiroptera: Vespertilionidae)

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Relationship between bone ageand pubertal breast stage to bone biomarkers and bone mineral density in healthy brazilian female adolescents

Background and Aims Bone metabolism involves understanding many factors, especially during puberty, when bone turnover is significant and the bone mass peak must be achieved as a protective factor of future bone health. The objective was to evaluate the behavior of formation and resorption bone biomarkers (BB) in function of biological maturation in female adolescents.Methods Evaluation of formation and resorption BB, osteocalcin (OC), bone alkaline phosphatase (BAP) and carboxyterminal telopeptide (S-CTx) by correlating them with bone mineralization, bone age and pubertal development in healthy female adolescents. Seventy-two volunteers were subdivided into groups according to chronological age/bone age (BA): 10 11 years (n=12), 12 13 years (n=16), 14 15 years (n=15) and 16 19 years (n=29). The following were evaluated: weight (kg), height (m), BMI (kg/m2), calcium intake (3-day 24h food recalls (mg/day), puberty events (Tanner stages), serum OC (ng/mL), BAP (U/L), S-CTx (ng/mL) and bone mineral density (BMD) as calculated by DXA (g/cm2) in the spine (L1-L4), proximal femur and whole body. The project was approved by the UNESP Ethics Committee.Results BB showed similar behaviors, with higher mean values for 10 12 years and when adolescents were in the B2-B3 Pubertal Maturation Stage (B2: BAP=110.16 U/L, OC=33.81ng/mL, S-CTx=1.66 ng/mL and B3: BAP=136.50 U/L, OC=39.15ng/mL and S-CTx=1.88 ng/mL; p<0.001). Mean BB values decreased with advancing BA and pubertal maturity.Conclusions BB values showed parallelism with peak height velocity and significant negative correlation with BMD in the different evaluated sites, with chronological and BA ; higher BMD values correlated with lower bone biomarker values.

Effects Of Programmed Physical Activity On Body Composition In Post-pubertal Schoolchildren.

To assess body composition modifications in post-pubertal schoolchildren after practice of a physical activity program during one school year. The sample consisted of 386 students aged between 15 and 17 years and divided into two groups: the study group (SG) comprised 195 students and the control group (CG), 191. The SG was submitted to a physical activity program and the CG attended conventional physical education classes. Body composition was assessed using body mass index (BMI), percentage of body fat (%BF), fat mass (FM), and lean mass (LM). A positive effect of the physical activity program on body composition in the SG (p<0.001) was observed, as well as on the interaction time x group in all the variables analyzed in both genders. A reduction in %BF (mean of differences = -5.58%) and waist circumference (-2.33cm), as well as an increase in LM (+2.05kg) were observed in the SG for both genders, whereas the opposite was observed in the CG. The practice of programmed physical activity promotes significant reduction of body fat in post-pubertal schoolchildren.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Comparative analysis of adverse events between infliximab and adalimumab in Crohn's disease management: a Brazilian single-centre experience

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Effects of a novel calcium aluminate cement on the early events of the progression of osteogenic cell cultures

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Engagement of multifocal neural circuits during recall of autobiographical happy events

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

Ambiente de desenvolvimento e início da vida reprodutiva em mulheres Brasileiras

Modelos teóricos inspirados na teoria da história de vida têm avaliado padrões de reprodução humanos em países desenvolvidos, com resultados ainda não conclusivos. Em vista das condições de vida na população brasileira, foram investigadas relações entre marcos da carreira reprodutiva feminina, condições ambientais e variáveis psicossociais relacionadas às condições de criação. Foram entrevistadas 606 mulheres em seis estados. Os resultados apóiam a teoria da história de vida, mostrando associações entre condições de vida na infância e início da vida sexual e da reprodução, mas não com a idade da menarca. Sugerimos que diferentes marcadores da vida reprodutiva podem estar sob controle de diferentes fenômenos e que a diversidade de condições da população brasileira oferece contextos alternativos para testar hipóteses.