Role of NonO-histone interaction in TNFalpha-suppressed prolyl-4-hydroxylase alpha1.

Inflammation is a key process in cardiovascular diseases. The extracellular matrix (ECM) of the vasculature is a major target of inflammatory cytokines, and TNFalpha regulates ECM metabolism by affecting collagen production. In this study, we have examined the pathways mediating TNFalpha-induced suppression of prolyl-4 hydroxylase alpha1 (P4Halpha1), the rate-limiting isoform of P4H responsible for procollagen hydroxylation, maturation, and organization. Using human aortic smooth muscle cells, we found that TNFalpha activated the MKK4-JNK1 pathway, which induced histone (H) 4 lysine 12 acetylation within the TNFalpha response element in the P4Halpha1 promoter. The acetylated-H4 then recruited a transcription factor, NonO, which, in turn, recruited HDACs and induced H3 lysine 9 deacetylation, thereby inhibiting transcription of the P4Halpha1 promoter. Furthermore, we found that TNFalpha oxidized DJ-1, which may be essential for the NonO-P4Halpha1 interaction because treatment with gene specific siRNA to knockout DJ-1 eliminated the TNFalpha-induced NonO-P4Halpha1 interaction and its suppression. Our findings may be relevant to aortic aneurysm and dissection and the stability of the fibrous cap of atherosclerotic plaque in which collagen metabolism is important in arterial remodeling. Defining this cytokine-mediated regulatory pathway may provide novel molecular targets for therapeutic intervention in preventing plaque rupture and acute coronary occlusion.

Beta-turns in nascent procollagen are sites of posttranslational enzymatic hydroxylation of proline

The selective hydroxylation of proline residues in nascent procollagen chains by prolyl hydroxylase (EC 1.14.11.2) can be understood in terms of the conformational feature of the -Pro-Gly-segments in linear peptides and globular proteins. The folded beta-turn conformation in such segments appears to be the conformational requirement for proline hydroxylation. The available data on the hydroxylation of native and synthetic substrates of prolyl hydroxylase are explained on the basis of the extent of beta-turn formation in them. Taken in conjunction with the conformational features of the hydroxyproline residue, our results bring out the conformational reason for the posttranslational proline hydroxylation which, it is proposed, leads to the "straightening" of the beta-turn segments into the linear triple-helical conformation.

Genetic studies in osteoporosis: The end of the beginning

Osteoporosis and disorders of bone fragility are highly heritable, but despite much effort the identities of few of the genes involved has been established. Recent developments in genetics such as genome-wide association studies are revolutionizing research in this field, and it is likely that further contributions will be made through application of next-generation sequencing technologies, analysis of copy number variation polymorphisms, and high-throughput mouse mutagenesis programs. This article outlines what we know about osteoporosis genetics to date and the probable future directions of research in this field.

Geometry Of Proline And Hydroxyproline .1. An Analysis Of X-Ray Crystal-Structure Data

We have carried out an analysis of crystal structure data on prolyl and hydroxyprolyl moieties in small molecules. The flexibility of the pyrrolidine ring due to the pyramidal character of nitrogen has been defined in terms of two projection angles δ1 and δ2. The distribution of these parameters in the crystal structures is found to be consistent with results of the energy calculations carried out on prolyl moieties in our laboratory.

Proline ring conformations corresponding to a bistable jump model from 13C spin-lattice relaxation times

A formalism for extracting the conformations of a proline ring based on the bistable jump model of R. E. London [(1978) J. Am. Chem. Soc. 100, 2678-2685] from 13C spin-lattice relaxation times (T1) is given. The method is such that the relaxation data are only partially used to generate the conformations; these conformations are constrained to satisfy the rest of the relaxation data and to yield acceptable ring geometry. An alternate equation for T1 of 13C nuclei to that of London is given. The formalism is illustrated through an example.

Proline-containing β-turns in peptides and proteins: Analysis of structural data on globular proteins

Tetrapeptide sequences of the type Z-Pro-Y-X were obtained from the crystal structure data on 34 globular proteins, and used in an analysis of the positional preferences of the individual amino acid residues in the β-turn conformation. The effect of fixing proline as the second position residue in the tetrapeptide sequence was studied by comparing the data obtained on the positional preferences with the corresponding data obtained by Chou and Fasman using the Z-R-Y-X sequence, where no particular residue was fixed in any of the four positions. While, in general, several amino acid residues having relatively very high or very low preferences for specific positions were found to be common to both the Z-Pro-Y-X and Z-R-Y-X sequences, many significant differences were found between the two sets of data, which are to be attributed to specific interactions arising from the presence of the proline residue.

Alterations in the activities of the enzymes of proline metabolism in Ragi (Eleusine coracana) leaves during water stress

Free proline content in Ragi (Eleusine coracana) leaves increased markedly (6 to 85 fold) as the degree of water stress, created by polyethylene gylcol treatment, was prolonged There was also a marginal increase in soluble proteins in the stressed leaves as compared to that in the controls. Water stress stimulated the activities of ornithine aminotransferase and pyrroline-5-carboxylate reductase, the enzymes of proline biosynthesis and markedly inhibited the enzymes involved in proline degradation viz., proline oxidase and pyrroline-5-carboxylate dehydrogenase. These results suggest that increase in free proline content of Ragi leaves could be due to enhanced activities of the enzymes synthesizing proline but more importantly due to severe inhibition of the enzymes degrading proline. These observations establish for the first time, the pathway of proline metabolism in plants by way of detection of the activities of all the enzymes involved and also highlight the role of these enzymes in proline accumulation during water stress.

Inhibition of cortisol-mediated induction of hepatic tryptophan-2,3-dioxygenase by norepinephrine

Norepinephrine inhibits cortisol-mediated induction of hepatic tryptophan pyrrolase in rats. During cold exposure the stabilization of this enzyme appears to occur by an interaction of corticoids and norepinephrine on the induction process.

Water stress induced alterations in ornithine aminotransferase of ragi (Eleusine coracana): Protection by proline against heat inactivation and denaturation by urea and guanidinium chloride

Water stress resulted in a specific response leading to a large and significant increase (80-fold) in free proline content of ragi (Eleusine coracana) leaves and seedlings. L-Proline protected ornithine aminotransferase, an enzyme in the pathway for proline biosynthesis, isolated from normal and stressed ragi leaves against heat inactivation and denaturation by urea and guanidinium chloride. The protection of the stressed enzyme by L-proline was much more complete than that of the enzyme isolated from normal leaves. While L-ornithine, one of the substrates, protected the stressed enzyme against inactivation, it enhanced the rate of inactivation of the normal enzyme. α-Ketoglutarate protected both the normal and stressed enzyme against inactivation and denaturation. These results support the suggestion that ornithine aminotransferase has undergone a structural alteration during water stress. In view of the causal relationship between elevated temperature and water stress of plants under natural conditions, the protection afforded by proline against inactivation and denaturation of the enzyme from stressed leaves assumes significance. These results provide an explanation for a possible functional importance of proline accumulation during water stress.

Crystal and molecular structure of allo-4-hydroxy-L-proline dihydrate

allo-4-Hydroxy-L-proline crystallizes from an aqueous solution as the dihydrate. The crystals are orthorhombic, space group P212121, with a=7.08 (2), b=22.13 (3), c= 5"20 (2) A,. The structure was solved by direct methods and refined by block-diagonal least squares. The final R for 733 observed reflexions is 0.054. The molecule exists as a zwitterion with hydroxyl and carboxyl groups cis to the pyrrolidine ring. The latter is puckered at the fl-carbon atom, which deviates by -0.54 A, from the best plane formed by the four remaining atoms. The molecules are held together by a network of hydrogen bonds, the water molecules playing a dominant role in the stability of the structure.

Inhibitory action of norepinephrine on the induction of tryptophan-2,3-dioxygenase by cortisol: Mediation by the I-receptor

Induction of hepatic tryptophan-2,3-dioxygenase in rats by cortisol or corticosterone was inhibited on treatment with norepinephrine. The I-adrenergic blockers showed a small potentiating effect of the norepinephrine-mediated inhibition. The I-adrenergic blockers significantly reversed this inhibition, suggesting that norepinephrine acts Image the I-receptor in inhibition of the cortisol-mediated induction of this enzyme.

Conformations of Heterochiral and Homochiral Proline-Pseudoproline Segments in Peptides: Context Dependent Cis-Trans Peptide Bond Isomerization

The pseudoproline residue (Psi Pro, L-2,2-dimethyl-1,3-thiazolidine-4-carboxylic acid) has been introduced into heterochiral diproline segments that have been previously shown to facilitate the formation of beta-hairpins, containing central two and three residue turns. NMR studies of the octapeptide Boc-Leu-Phe-Val-(D)Pro-Psi Pro-Leu-Phe-Val-OMe (1), Boc-Leu-Val-Val-(D)Pro-Psi Pro-Leu-Val-Val-OMe (2), and the nonapeptide sequence Boc-Leu-Phe-Val-(D)Pro-Psi Pro-(D)Ala-Leu-Phe-Val-OMe (3) established well-registered beta-hairpin structures in chloroform solution, with the almost exclusive population of the trans conformation for the peptide bond preceding the Psi Pro residue. The beta-hairpin conformation of 1 is confirmed by single crystal X-ray diffraction. Truncation of the strand length in Boc-Val-(D)Pro-Psi Pro-Leu-OMe (4) results in air increase in the population of the cis conformer, with a cis/trans ratio of 3.65. Replacement of Psi Pro in 4 by (L)Pro in 5, results in almost exclusive population of the trans form, resulting in an incipient beta-hairpin conformation, stabilized by two intramolecular hydrogen bonds. Further truncation of the sequence gives an appreciable rise in the population of cis conformers in the tripeptide piv-(D)Pro-Psi Pro-Leu-OMe (6). In the homochiral segment Piv-Pro Psi Pro-Leu-OMe (7) only the cis form is observed with the NMR evidence strongly supporting a type VIa beta-turn conformation, stabilized by a 4 -> 1 hydrogen bond between the Piv (CO) and Leu (3) NH groups. The crystal structure of the analog peptide 7a (Piv-Pro-Psi(H,CH3)Pro-Leu-NHMe) confirms the cis peptide bond geometry for the Pro-Psi(H,CH3)pro peptide bond, resulting in a type VIa beta-turn conformation.

Nucleotide sequence of a cucumber chloroplast proline tRNA

The nucleotide sequence of a proline tRNA (anticodon UGG) from cucumber chloroplasts has been determined. The sequence is: pAAGGAUGUAGCGCAGCUUCADAGCGCAΨUUGUUUUGGNΨFACAAAAUm7GUCACGGGTΨCAAAUCCUGUCAUCCUUACCAOH. It shows 93% homology with spinach chloroplast tRNAPro (UGG) and 72% homology with bean mitochondrial tRNA Pro (UGG), the other two known plant organellar tRNAsPro.