Ethnicity and glutathione S-transferase (GSTM1/GSTT1) polymorphisms in a Brazilian population

The distribution of polymorphisms related to glutathione S-transferases (GST) has been described in different populations, mainly for white individuals. We evaluated the distribution of GST mu (GSTM1) and theta (GSTT1) genotypes in 594 individuals, by multiplex PCR-based methods, using amplification of the exon 7 of CYP1A1 gene as an internal control. In São Paulo, 233 whites, 87 mulattos, and 137 blacks, all healthy blood-donor volunteers, were tested. In Bahia, where black and mulatto populations are more numerous, 137 subjects were evaluated. The frequency of the GSTM1 null genotype was significantly higher among whites (55.4%) than among mulattos (41.4%; P = 0.03) and blacks (32.8%; P < 0.0001) from São Paulo, or Bahian subjects in general (35.7%; P = 0.0003). There was no statistically different distribution among any non-white groups. The distribution of GSTT1 null genotype among groups did not differ significantly. The agreement between self-reported and interviewer classification of skin color in the Bahian group was low. The interviewer classification indicated a gradient of distribution of the GSTM1 null genotype from whites (55.6%) to light mulattos (40.4%), dark mulattos (32.0%) and blacks (28.6%). However, any information about race or ethnicity should be considered with caution regarding the bias introduced by different data collection techniques, specially in countries where racial admixture is intense, and ethnic definition boundaries are loose. Because homozygous deletions of GST gene might be associated with cancer risk, a better understanding of chemical metabolizing gene distribution can contribute to risk assessment of humans exposed to environmental carcinogens.

Preliminary population study of Methylenetetrahydrofolate Reductase (MTHFR) C677T polymorphism determination in a pilot group of students from the University of Rosario

 Introduction: the 5, 10-methylenetetrahydrofolate reductase (MTHFR) is an essential enzyme in folate metabolism; their polymorphisms have been associated with heart disease risk increase, obstetric problems, neural tube defects in fetuses and cancer susceptibility. This gene has a single nucleotide polymorphism, a C-T change at nucleotide 677, which affects significantly its enzymatic activity. Objective: because of the biological importance of this enzyme and the Colombian population genetic heterogeneity characteristic, a study was performed to determine allele and genotype frequencies of MTHFR C677T polymorphism in healthy individuals, taking into account that in Colombia there are only studies that have involved case-control methodology. Methods: we analyzed this polymorphism trough the amplification of the DNA of a 206 students sample population. Additionally, Colombian overall frequencies were calculated, using data from healthy controls reported in other studies. Results: a Hardy-Weinberg disequilibri m was found in the sample tested. For the Colombian data, we found that the global population was in equilibrium. Conclusion: T allele population frequency seems to be under positive selection pressure, which is reflected in the population allele increase, despite its deleterious effect. A Spanish study reported similar results and identified folic acid supplementation on expectant mothers as a probably cause of this change. 

Population and Computational Analysis of the MGEA6 P521A Variation as a Risk Factor for Familial Idiopathic Basal Ganglia Calcification (Fahr`s Disease)

Familial idiopathic basal ganglia calcification, also known as ""Fahr`s disease"" (FD), is a neuropsychiatric disorder with autosomal dominant pattern of inheritance and characterized by symmetric basal ganglia calcifications and, occasionally, other brain regions. Currently, there are three loci linked to this devastating disease. The first one (IBGC1) is located in 14q11.2-21.3 and the other two have been identified in 2q37 (IBGC2) and 8p21.1-q11.13 (IBGC3). Further studies identified a heterozygous variation (rs36060072) which consists in the change of the cytosine to guanine located at MGEA6/CTAGE5 gene, present in all of the affected large American family linked to IBGC1. This missense substitution, which induces changes of a proline to alanine at the 521 position (P521A), in a proline-rich and highly conserved protein domain was considered a rare variation, with a minor allele frequency (MAF) of 0.0058 at the US population. Considering that the population frequency of a given variation is an indirect indicative of potential pathogenicity, we screened 200 chromosomes in a random control set of Brazilian samples and in two nuclear families, comparing with our previous analysis in a US population. In addition, we accomplished analyses through bioinformatics programs to predict the pathogenicity of such variation. Our genetic screen found no P521A carriers. Polling these data together with the previous study in the USA, we have now a MAF of 0.0036, showing that this mutation is very rare. On the other hand, the bioinformatics analysis provided conflicting findings. There are currently various candidate genes and loci that could be involved with the underlying molecular basis of FD etiology, and other groups suggested the possible role played by genes in 2q37, related to calcium metabolism, and at chromosome 8 (NRG1 and SNTG1). Additional mutagenesis and in vivo studies are necessary to confirm the pathogenicity for variation in the P521A MGEA6.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)(n) trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATATTATATATTATATCTAATAATATAT(C)/(A)TA)(n) (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Dermatophyte agents in the city of São Paulo, from 1992 to 2002

Dermatophytosis are superficial mycoses caused by fungi that can invade stratum corneum and keratinized tissues. In order to study the frequency of dermatophytes species and the clinical manifestations caused by these fungi, in São Paulo, SP, Brazil, the authors analyzed cultures isolated at the Mycology Laboratory from a selected population (15,300 out-patients of the Hospital das Clínicas, Department of Dermatology, Faculty of Medicine of University of São Paulo) from January 1992 to June 2002. The most prevalent dermatophyte was Trichophyton rubrum (48.7%), followed by Microsporum canis (20.9%), Trichophyton tonsurans (13.8%), Trichophyton mentagrophytes (9.7%), Epidermophyton floccosum (4.1%), and Microsporum gypseum (2.5%). These agents determined more than one clinical manifestation, i.e., tinea corporis (31.5%), tinea capitis (27.5%), tinea unguium (14.8%), tinea cruris (13.9%), tinea pedis (9.9%), and tinea manuum (1.9%). Clinical variants of dermatophytosis and their relationship to the etiologic agents were studied and the results were compared to those obtained in previous studies in other regions of Brazil and in other countries.

Rare genomic structural variants in complex disease: lessons from the replication of associations with obesity.

The limited ability of common variants to account for the genetic contribution to complex disease has prompted searches for rare variants of large effect, to partly explain the 'missing heritability'. Analyses of genome-wide genotyping data have identified genomic structural variants (GSVs) as a source of such rare causal variants. Recent studies have reported multiple GSV loci associated with risk of obesity. We attempted to replicate these associations by similar analysis of two familial-obesity case-control cohorts and a population cohort, and detected GSVs at 11 out of 18 loci, at frequencies similar to those previously reported. Based on their reported frequencies and effect sizes (OR≥25), we had sufficient statistical power to detect the large majority (80%) of genuine associations at these loci. However, only one obesity association was replicated. Deletion of a 220 kb region on chromosome 16p11.2 has a carrier population frequency of 2×10(-4) (95% confidence interval [9.6×10(-5)-3.1×10(-4)]); accounts overall for 0.5% [0.19%-0.82%] of severe childhood obesity cases (P = 3.8×10(-10); odds ratio = 25.0 [9.9-60.6]); and results in a mean body mass index (BMI) increase of 5.8 kg.m(-2) [1.8-10.3] in adults from the general population. We also attempted replication using BMI as a quantitative trait in our population cohort; associations with BMI at or near nominal significance were detected at two further loci near KIF2B and within FOXP2, but these did not survive correction for multiple testing. These findings emphasise several issues of importance when conducting rare GSV association, including the need for careful cohort selection and replication strategy, accurate GSV identification, and appropriate correction for multiple testing and/or control of false discovery rate. Moreover, they highlight the potential difficulty in replicating rare CNV associations across different populations. Nevertheless, we show that such studies are potentially valuable for the identification of variants making an appreciable contribution to complex disease.

Fourteen new cases contribute to the characterization of the 7q11.23 microduplication syndrome.

Interstitial deletions of 7q11.23 cause Williams-Beuren syndrome, one of the best characterized microdeletion syndromes. The clinical phenotype associated with the reciprocal duplication however is not well defined, though speech delay is often mentioned. We present 14 new 7q11.23 patients with the reciprocal duplication of the Williams-Beuren syndrome critical region, nine familial and five de novo. These were identified by either array-based MLPA or by array-CGH/oligonucleotide analysis in a series of patients with idiopathic mental retardation with an estimated population frequency of 1:13,000-1:20,000. Variable speech delay is a constant finding in our patient group, confirming previous reports. Cognitive abilities range from normal to moderate mental retardation. The association with autism is present in five patients and in one father who also carries the duplication. There is an increased incidence of hypotonia and congenital anomalies: heart defects (PDA), diaphragmatic hernia, cryptorchidism and non-specific brain abnormalities on MRI. Specific dysmorphic features were noted in our patients, including a short philtrum, thin lips and straight eyebrows. Our patient collection demonstrates that the 7q11.23 microduplication not only causes language delay, but is also associated with congenital anomalies and a recognizable face.

An ancient founder mutation in PROKR2 impairs human reproduction.

Congenital gonadotropin-releasing hormone (GnRH) deficiency manifests as absent or incomplete sexual maturation and infertility. Although the disease exhibits marked locus and allelic heterogeneity, with the causal mutations being both rare and private, one causal mutation in the prokineticin receptor, PROKR2 L173R, appears unusually prevalent among GnRH-deficient patients of diverse geographic and ethnic origins. To track the genetic ancestry of PROKR2 L173R, haplotype mapping was performed in 22 unrelated patients with GnRH deficiency carrying L173R and their 30 first-degree relatives. The mutation's age was estimated using a haplotype-decay model. Thirteen subjects were informative and in all of them the mutation was present on the same ~123 kb haplotype whose population frequency is ≤10%. Thus, PROKR2 L173R represents a founder mutation whose age is estimated at approximately 9000 years. Inheritance of PROKR2 L173R-associated GnRH deficiency was complex with highly variable penetrance among carriers, influenced by additional mutations in the other PROKR2 allele (recessive inheritance) or another gene (digenicity). The paradoxical identification of an ancient founder mutation that impairs reproduction has intriguing implications for the inheritance mechanisms of PROKR2 L173R-associated GnRH deficiency and for the relevant processes of evolutionary selection, including potential selective advantages of mutation carriers in genes affecting reproduction.

Trends in systemic lupus erythematosus mortality rates in the state of Sao Paulo, Brazil from 1985 to 2004

Objectives To estimate mortality rates and mortality trends from SLE in the state of Sao Paulo, Brazil. Material and methods The official data bank was used to study all deaths occurred from 1985 to 2004 in which SLE was mentioned as the underlying cause of death. Besides the overall mortality rate, the annual gender- and age-specific mortality rates were estimated for each calendar year by age bracket (0-19 years, 20-39 years, 40-59 years and over 60 years) and for the sub-periods 1985-1995 (first) and 1996-2004 (second), by decades. Chi-square test was used to compare the mortality rates between the two periods, as well the mortality rates according to educational level considering years of study. Pearson correlation coefficient test was used to analyse mortality trends. The crude rates were adjusted for age by the direct method, using the standard Brazilian population in 2000. Results A total of 2,601 deaths (90% female) attributed to SLE were analysed. The mean age at death was significantly higher in the second than in the first sub-period (36.6 +/- 15.6 years vs. 33.9 +/- 14.0 years; p<0.001). The overall adjusted mortality rate was 3.8 deaths/million habitants/year for the entire period and 3.4 deaths/million inhabitants/year for the first and 4.0 deaths/million inhabitants/year for the second sub-period (p<0.001). In each calendar year, the mortality rate was significantly lower for the better educated group. Throughout the period, there was a significant increase in mortality rates only among women over 40. Conclusion SLE patients living in the state of Silo Paulo still die at younger ages than those living in developed countries. Our data do not support the theory that there was an improvement in the SLE mortality rate in the last 20 years in the state of Sao Paulo. Socio-economic factors, such as the difficulty to get medical care and adequate treatment, may be the main factors to explain the worst prognosis for our patients.

Human toxocariasis in rural Brazilian Amazonia: Seroprevalence, risk factors, and spatial distribution

This population-based cross-sectional study of 403 rural settlers in Brazilian Amazonia revealed an overall rate of IgG seropositivity to Toxocara canis excretory-secretory larval antigen of 26.8% (95% confidence interval [CI], 22.5-31.4%). Multilevel logistic regression analysis identified current infection with hookworm (odds ratio [OR], 2.32; 95% CI, 1.11-4.86) and residence in the most recently occupied sectors of the settlement (OR, 1.81.; 95%CI, 1.3-2.52) as significant risk factors for Toxocara seropositivity; age > 14 years (OR, 0.46; 95% CI, 0.28-0.73) and the presence of cats in the household (OR, 0.57; 95% CI, 0.32-1.02) appeared to be protective. Two significant high-prevalence clusters were detected in the area, together comprising 38.9% of the seropositive subjects; households in the clusters had slightly lower socioeconomic status and were less likely to have cats as pets. The obstacles for controlling human toxocariasis in this and other tropical rural settings are discussed.

São Vicente (RN) nos primeiros anos da TV: Memória, sociabilidade e cotidiano

The present work aims to reflect on the everyday and its Vincentian practices of sociability in the early years of the presence of television in the city of São Vicente (RN), from the memories of the protagonists who witnessed the first insertion of TV set sin the beginning sof 1970s.Thus, the research was guided by some questions deemed relevant to the study in order to understand the most significant changes in the daily Vincentian boosted by the arrival of television in some private houses, which soon became a meeting place, recreation and sociability. At that time, filled the role of TV unites and brings people together. These houses, reinvented in spaces of sociability, were sanctioned by the various actors who gathered daily to include television programming. This popularity of television was measured by the joint efforts of people who moved their homes to homes that had this technical device. Each home with their uniqueness sand peculiarity, which attracted the population frequency f these spaces were frequent. Of course people still sit on the sidewalks, to be held the night rides in the streets and square, but soon came to the program schedule Preferred came into leaving their homes or to homes that had TV, watch them in the design of audiovisual programs. We use the oral memory as the principal methodology in order to interpret the memories recounted by people who lived in that time period studied. For this purpose we constructed a narrative that highlights the categories memory, media, social practices, everyday life and thus has the theoretical and methodological contributions of authors of humanities and social sciences its main foundation. In field research in the use of in-depth interviews, since the narratives of our research is interviewed. The importance of a study of such order, is not only in understanding the TV as an essential mediator for the interaction of individuals in society, from 1970 in São Vicente (RN), but also for the unveiling of his relationship with the daily routines of the Vincentians, founded in environments and symbols that regulated the conduct and reordered the social practices and sociability of these subjects. In this sense, the making of a work on the presence of TV in the city of São Vicente (RN) is also of paramount importance for the history of this media at the national level, since this is nothing more than a set of multiple stories

An ancient founder mutation in PROKR2 impairs human reproduction

Congenital gonadotropin-releasing hormone (GnRH) deficiency manifests as absent or incomplete sexual maturation and infertility. Although the disease exhibits marked locus and allelic heterogeneity, with the causal mutations being both rare and private, one causal mutation in the prokineticin receptor, PROKR2 L173R, appears unusually prevalent among GnRH-deficient patients of diverse geographic and ethnic origins. To track the genetic ancestry of PROKR2 L173R, haplotype mapping was performed in 22 unrelated patients with GnRH deficiency carrying L173R and their 30 first-degree relatives. The mutations age was estimated using a haplotype-decay model. Thirteen subjects were informative and in all of them the mutation was present on the same approximate to 123 kb haplotype whose population frequency is 10. Thus, PROKR2 L173R represents a founder mutation whose age is estimated at approximately 9000 years. Inheritance of PROKR2 L173R-associated GnRH deficiency was complex with highly variable penetrance among carriers, influenced by additional mutations in the other PROKR2 allele (recessive inheritance) or another gene (digenicity). The paradoxical identification of an ancient founder mutation that impairs reproduction has intriguing implications for the inheritance mechanisms of PROKR2 L173R-associated GnRH deficiency and for the relevant processes of evolutionary selection, including potential selective advantages of mutation carriers in genes affecting reproduction.

Prevalence of systemic diseases in Brisbane general and periodontal practice patients

Background: Periodontitis has been associated with a number of systemic diseases such as atherosclerosis, coronary heart diseases, and respiratory diseases. This study aimed to determine whether there is a significant difference in the prevalence of systemic diseases (a) in patients referred for periodontal care compared to the general practice population, (b) in patients attending a public hospital and private practices, (c) in patients attending public and private periodontal practices, and (d) among patients with periodontitis of varying severity. Methods: Charts of 1000 adult patients were selected from four clinics (University of Queensland (UQ) School of Dentistry Admissions Clinic, UQ School of Dentistry Periodontics Clinic, Private Periodontal Practice, and Private General Dental Practice). The prevalence of medical conditions was evaluated using validated self-reported health questionnaires. The periodontal condition was assessed from the most recent relevant radiographs in the files. Results: Periodontal patients had a higher prevalence of systemic diseases compared to the general practice population. Public patients had a greater prevalence of systemic diseases compared to patients in private practice for both general practice and periodontal patients. In patients with advanced periodontitis, bronchitis, hepatitis and rheumatoid arthritis were most prevalent. Patients with periodontitis also took more medications and were more likely to suffer from multiple conditions compared to the general dental population. Conclusions: Patients attending public dental facilities have an increased prevalence of systemic disease compared to those attending private practices. Furthermore periodontal patients have a greater prevalence of disease compared to general practice patients. Patients with moderate or advanced periodontitis show an increase in the prevalence of some systemic diseases previously reported to be risk factors for periodontal disease.

Increased prevalence of sex chromosome aneuploidies in specific language impairment and dyslexia

Aim: Sex chromosome aneuploidies increase the risk of spoken or written language disorders but individuals with specific language impairment (SLI) or dyslexia do not routinely undergo cytogenetic analysis. We assess the frequency of sex chromosome aneuploidies in individuals with language impairment or dyslexia. Method: Genome-wide single nucleotide polymorphism genotyping was performed in three sample sets: a clinical cohort of individuals with speech and language deficits (87 probands: 61 males, 26 females; age range 4 to 23 years), a replication cohort of individuals with SLI, from both clinical and epidemiological samples (209 probands: 139 males, 70 females; age range 4 to 17 years), and a set of individuals with dyslexia (314 probands: 224 males, 90 females; age range 7 to 18 years). Results: In the clinical language-impaired cohort, three abnormal karyotypic results were identified in probands (proband yield 3.4%). In the SLI replication cohort, six abnormalities were identified providing a consistent proband yield (2.9%). In the sample of individuals with dyslexia, two sex chromosome aneuploidies were found giving a lower proband yield of 0.6%. In total, two XYY, four XXY (Klinefelter syndrome), three XXX, one XO (Turner syndrome), and one unresolved karyotype were identified. Interpretation: The frequency of sex chromosome aneuploidies within each of the three cohorts was increased over the expected population frequency (approximately 0.25%) suggesting that genetic testing may prove worthwhile for individuals with language and literacy problems and normal non-verbal IQ. Early detection of these aneuploidies can provide information and direct the appropriate management for individuals. © 2013 The Authors. Developmental Medicine & Child Neurology published by John Wiley & Sons Ltd on behalf of Mac Keith Press.

Frequency and genotypic distribution of GB virus C (GBV-C) among Colombian population with Hepatitis B (HBV) or Hepatitis C (HCV) infection

Background: GB virus C (GBV-C) is an enveloped positive-sense ssRNA virus belonging to the Flaviviridae family. Studies on the genetic variability of the GBV-C reveals the existence of six genotypes: genotype 1 predominates in West Africa, genotype 2 in Europe and America, genotype 3 in Asia, genotype 4 in Southwest Asia, genotype 5 in South Africa and genotype 6 in Indonesia. The aim of this study was to determine the frequency and genotypic distribution of GBV-C in the Colombian population. Methods: Two groups were analyzed: i) 408 Colombian blood donors infected with HCV (n = 250) and HBV (n = 158) from Bogota and ii) 99 indigenous people with HBV infection from Leticia, Amazonas. A fragment of 344 bp from the 5' untranslated region (5' UTR) was amplified by nested RT PCR. Viral sequences were genotyped by phylogenetic analysis using reference sequences from each genotype obtained from GenBank (n = 160). Bayesian phylogenetic analyses were conducted using Markov chain Monte Carlo (MCMC) approach to obtain the MCC tree using BEAST v. 1.5.3. Results: Among blood donors, from 158 HBsAg positive samples, eight 5.06% (n = 8) were positive for GBV-C and from 250 anti-HCV positive samples, 3.2%(n = 8) were positive for GBV-C. Also, 7.7% (n = 7) GBV-C positive samples were found among indigenous people from Leticia. A phylogenetic analysis revealed the presence of the following GBV-C genotypes among blood donors: 2a (41.6%), 1 (33.3%), 3 (16.6%) and 2b (8.3%). All genotype 1 sequences were found in co-infection with HBV and 4/5 sequences genotype 2a were found in co-infection with HCV. All sequences from indigenous people from Leticia were classified as genotype 3. The presence of GBV-C infection was not correlated with the sex (p = 0.43), age (p = 0.38) or origin (p = 0.17). Conclusions: It was found a high frequency of GBV-C genotype 1 and 2 in blood donors. The presence of genotype 3 in indigenous population was previously reported from Santa Marta region in Colombia and in native people from Venezuela and Bolivia. This fact may be correlated to the ancient movements of Asian people to South America a long time ago.