Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Variations in the sensitivity of different primers for detecting Wolbachia in Anastrepha (diptera: tephritidae)

Wolbachia are endosymbiont bacteria of the family Rickettsiacea that are widespread in invertebrates and occur between 20% and 60% of Neotropical insects. These bacteria are responsible for reproductive phenomena such as cytoplasmic incompatibility, male killing, feminization and parthenogenesis. Supergroups A and B of Wolbachia are common in insects and can be identified using primers for 16S rDNA, ftsZ and wsp; these primers vary in their ability to detect Wolbachia. The ftsZ primer was the first primer used to detect Wolbachia in Anastrepha fruit flies. The primers for 16S rDNA, ftsZ and wsp and the corresponding PCR conditions have been optimized to study the distribution of Wolbachia and their effect on the biology of Anastrepha in Brazil. In this work, we examined the ability of these primers to detect Wolbachia in Anastrepha populations from three regions in the State of São Paulo, southeastern Brazil. All of the samples were positive for Wolbachia supergroup A when screened with primers for 16S A rDNA and wsp A; the wsp B primer also gave a positive result, indicating cross-reactivity. The ftsZ primer showed a poor ability to detect Wolbachia in Anastrepha and generated false negatives in 44.9% of the samples. These findings indicate that reliable PCR detection of Wolbachia requires the use of primers for 16S rDNA and wsp to avoid cross-reactions and false negatives, and that the ftsZ primer needs to be redesigned to improve its selectivity.

Molecular detection and differentiation of Brazilian and African isolates of the entomopathogen Neozygites tanajoae (Entomophthorales: Neozygitaceae) with PCR using specific primers

Neozygites tanajoae is an entomopathogenic fungus which has been used for biocontrol of the cassava green mite (Mononychellus tanajoa, CGM) in Africa. Establishment and dispersal of Brazilian isolates which have been introduced into some African countries in recent years to improve CGM control was followed with specific PCR assays. Two primer pairs, NEOSSU_F/NEOSSU_R and 8DDC_F/8DDC_R, were used to differentiate isolates collected from several locations in Brazil and from three countries in Africa, Benin, Ghana and Tanzania. The first primer pair enabled the species-specific detection of Neozygites tanajoae, while the second differentiated the Brazilian isolates from those of other geographical origin. PCR assays were designed for detection of fungal DNA in the matrix of dead infested mites since N. tanajoae is difficult to isolate and culture on selective artificial media. Our results show that all isolates (Brazilian and African) that sporulated on mummified mites were amplified with the first primer pair confirming their Neozygites tanajoae identity. The second pair amplified DNA from all the Brazilian isolates, but did not amplify any DNA samples from the African isolates. None of the two primers showed amplification neither from any of the non-sporulating mite extracts nor from the dead uninfected mites used as negative controls. We confirmed that the two primer pairs tested are suitable for the detection and differential identification of N. tanajoae isolates from Brazil and Africa and that they are useful to monitor the establishment and spread of the Brazilian isolates of N. tanajoae introduced into Benin or into other African countries for improvement of CGM biocontrol.

Development and characterization of microsatellite markers for Psychotria tenuinervis (Rubiaceae), a shrub species from the Atlantic forest, and primers transferability from Coffea

The shrub species Psychotria tenuinervis (Rubiaceae) is native to the Brazilian Atlantic forest and is largely found within natural and disturbed forest fragments. Aiming to develop studies on population genetic structure of forest fragment species, eigth microsatellite markers were developed for P. tenuinervis. Also, 15 loci already developed for Coffea (Rubiaceae) were tested for transferability to this species. We utilized 45 individuals from natural populations of three different fragments-anthropic edge, interior fragment and natural edge, within the Brazilian Atlantic forest. The average number of alleles per locus was 2.5 (two-four alleles/locus). These loci will be useful for future population genetic studies aiming to the conservation and management of this species.

A novel method for development of species and strain-specific DNA probes and PCR primers for identifying Burkholderia solanacearum (formerly Pseudomonas solanacearum)

Six Burkholderia solanacearum (formerly Pseudomonas solanacearum) genomic DNA fragments were isolated, using RAPD techniques and cloning, from the three genetically diverse strains: ACH092 (Biovar 4), ACH0158 (Biovar 2) and ACH0171 (Biovar 3) (1). One of these cloned fragments was selected because it was present constantly in all bacterial strains analysed. The remaining five clones were selected because Southern hybridisation revealed that each showed partial or complete specificity towards the strain of origin. A seventh genomic fragment showing a strain-specific distribution in Southern hybridisations was obtained by differential restriction, hybridisation and cloning of genomic DNA. Each of these clones was sequenced and primers to amplify the insert were designed. When DNA from the strain of origin was used as template, PCR amplification for each of these fragments yielded a single band on gel analysis. One pair of primers amplified the species-constant fragment of 281 bp from DNA of all B. solanacearum strains investigated, from DNA of the closely related bacterium which causes ''blood disease'' of banana (BDB) and in P. syzigii. The sensitivity of detection of B. solanacearum using these ubiquitous primers was between 1.3 and 20 bacterial cells. The feasibility and reliability of a PCR approach to detection and identification of B. solanacearum was tested in diverse strains of the bacterium in several countries and laboratories.

EFFECT OF METAL PRIMERS ON MICROTENSILE BOND STRENGTH BETWEEN ZIRCONIA AND RESIN CEMENTS

Statement of problem. There are no established clinical procedures for bonding zirconia to tooth structure using resin cements. Purpose. The purpose of this study was to evaluate the influence of metal primers, resin cements, and aging on bonding to zirconia. Material and methods. Zirconia was treated with commercial primers developed for bonding to metal alloys (Metaltite, Metal Primer II, Alloy Primer or Totalbond). Non-primed specimens were considered as controls. One-hundred disk-shaped specimens (19 x 4 mm) were cemented to composite resin substrates using Panavia or RelyX Unicem (n=5). Microtensile bond strength specimens were tested after 48 hours and 5 months (150 days), and failure modes were classified as type 1 (between ceramic/cement), 2 (between composite resin/cement) or 3 (mixed). Data were analyzed by 3-way ANOVA and Multiple Comparison Tukey test (alpha=.05). Results. The interactions primer/luting system (P=.016) and luting system/storage time (P=.004) were statistically significant. The use of Alloy Primer significantly improved the bond strength of RelyX Unicem (P<.001), while for Panavia, none of the primers increased the bond strength compared to the control group. At 48 hours, Panavia had statistically higher bond strength (P=.004) than Unicem (13.9 +/- 4.4MPa and 10.2 +/- 6.6MPa, respectively). However, both luting systems presented decreasing, statistically similar; values after aging (Panavia: 3.6 +/- 2.2MPa; Unicem: 6.1 +/- 5.3MPa). At 48 hours, Alloy Primer/Unicem had the lowest incidence of type 1 failure (8%). After aging, all the groups showed a predominance of type 1 failures. Conclusions. The use of Alloy Primer improved bond strength between RelyX Unicem and zirconia. Though the initial values obtained with Panavia were significantly higher than RelyX Unicem, after aging, both luting agents presented statistically similar performances. (J Prosthet Dent 2011;105:296-303)

PCR with Paracoccidioides brasiliensis specific primers: potential use in ecological studies

The precise microenvironment of Paracoccidioides brasiliensis has not yet been discovered perhaps because the methods used are not sensitive enough. We applied to this purpose the polymerase chain reaction (PCR) using three sets of specific primers corresponding to two P. brasiliensis genes. This fungus as well as several other fungi, were grown and their DNA obtained by mechanical disruption and a phenol chloroform isoamylalcohol-based purification method. The DNA served for a PCR reaction that employed specific primers from two P. brasiliensis genes that codify for antigenic proteins, namely, the 27 kDa and the 43 kDa. The lowest detection range for the 27 kDa gene was 3 pg. The amplification for both genes was positive only with DNA from P. brasiliensis; additionally, the mRNA for the 27 kDa gene was present only in P. brasiliensis, as indicated by the Northern analysis. The standardization of PCR technology permitted the amplification of P. brasiliensis DNA in artificially contaminated soils and in tissues of armadillos naturally infected with the fungus. These results indicate that PCR technology could play an important role in the search for P. brasiliensis’ habitat and could also be used in other ecological studies.

NEW PRIMERS FOR DETECTION OF Leishmania infantum USING POLYMERASE CHAIN REACTION

SUMMARY Leishmania infantum causes visceral leishmaniasis (VL) in the New World. The diagnosis of VL is confirmed by parasitological and serological tests, which are not always sensitive or specific. Our aim was to design new primers to perform a Polymerase Chain Reaction (PCR) for detecting L. infantum. Sequences of the minicircle kinetoplast DNA (kDNA) were obtained from GenBank, and the FLC2/RLC2 primers were designed. Samples of DNA from L. infantum, Leishmania amazonensis, Leishmania braziliensis, Leishmania guyanensis, Leishmania naiffi, Leishmania lainsoni, Leishmania panamensis, Leishmania major and Trypanosoma cruzi were used to standardize the PCR. PCR with FLC2/RLC2 primers amplified a fragment of 230 bp and the detection limit was 0.2 fg of L. infantum DNA. Of the parasite species assayed, only L. infantum DNA was amplified. After sequencing, the fragment was aligned to GenBank sequences, and showed (99%) homology with L. infantum. In the analysis of blood samples and lesion biopsy from a dog clinically suspected to have VL, the PCR detected DNA from L. infantum. In biopsy lesions from humans and dogs with cutaneous leishmaniasis, the PCR was negative. The PCR with FLC2/RLC2 primers showed high sensitivity and specificity, and constitutes a promising technique for the diagnosis of VL.

PERFORMANCE OF CONVENTIONAL PCRs BASED ON PRIMERS DIRECTED TO NUCLEAR AND MITOCHONDRIAL GENES FOR THE DETECTION AND IDENTIFICATION OF Leishmania spp.

In visceral leishmaniasis, the detection of the agent is of paramount importance to identify reservoirs of infection. Here, we evaluated the diagnostic attributes of PCRs based on primers directed to cytochrome-B (cytB), cytochrome-oxidase-subunit II (coxII), cytochrome-C (cytC), and the minicircle-kDNA. Although PCRs directed to cytB, coxII, cytC were able to detect different species of Leishmania, and the nucleotide sequence of their amplicons allowed the unequivocal differentiation of species, the analytical and diagnostic sensitivity of these PCRs were much lower than the analytical and diagnostic sensitivity of the kDNA-PCR. Among the 73 seropositive animals, the asymptomatic dogs had spleen and bone marrow samples collected and tested; only two animals were positive by PCRs based on cytB, coxII, and cytC, whereas 18 were positive by the kDNA-PCR. Considering the kDNA-PCR results, six dogs had positive spleen and bone marrow samples, eight dogs had positive bone marrow results but negative results in spleen samples and, in four dogs, the reverse situation occurred. We concluded that PCRs based on cytB, coxII, and cytC can be useful tools to identify Leishmania species when used in combination with automated sequencing. The discordance between the results of the kDNA-PCR in bone marrow and spleen samples may indicate that conventional PCR lacks sensitivity for the detection of infected dogs. Thus, primers based on the kDNA should be preferred for the screening of infected dogs.

Els primers llums del Delta

Treball de recerca realitzat per un alumne d'ensenyament secundari i guardonat amb un Premi CIRIT per fomentar l'esperit científic del Jovent l'any 2009. El treball és un estudi de l’evolució, tan tècnica com estètica dels fars paral•lela als avenços tecnològics i prenent com a protagonistes els singulars fars de ferro que es varen construir durant la segona meitat del segle XIX i varen funcionar durant un llarguíssim període en el delta de l’Ebre. L’estructura de ferro, ancorada directament sobre les sorres del delta va donar un caràcter especial a aquestes construccions que, d’altra banda, constituïen una tipologia única a Catalunya i a Espanya. Aquests fars van rebre el nom del lloc on foren ubicats estratègicament. De sud a nord: far de la Banya, far de Buda i far del Fangar. Els van projectar conjuntament, es van encendre per primera vegada el mateix dia, van ser l’habitatge dels seus faroners, van anar evolucionant tècnicament tots tres però el final de cadascun d’ells va ser molt diferent. La història dels fars de ferro ha anat lligada al paisatge i la vida d’aquestes singulars terres del Delta i després de més d’un segle de servei foren substituïts per altres que estèticament i tècnicament res tenen a veure amb els seus antecessors.

Aplicació de la semblança molecular quàntica en la reducció de l'espai configuracional per a l'estat fonamental i primers excitats de l'àtom d'Heli

Es presenta un mètode de selecció d'orbitals atòmics relacionat amb la teoria de la Semblança Molecular Quàntica, que permet reduir l'espai actiu quan es vol dur a terme un càlcul a nivell d'Interacció de Configuracions per a l'àtom d'heli

Els primers historiadors de la ciutat: Jeroni Pau i Dionís Jeroni Jorba

Text de la conferència pronunciada per Mariàngela Vilallonga on es fa un repàs biogràfic dels historiadors Jeroni Pau i Dionís Jeroni Jorba, així com de la seva obra, és a dir, els primers textos que tenien a Barcelona com a matèria d’estudi