358 resultados para Microrganismo entomopatogênico


Relevância:

20.00% 20.00%

Publicador:

Resumo:

Este fungo foi isolado pela primeira vez de lagartas de L. obliqua de uma agregação em plátano (Platanus acerifolia (Aiton) Wild - Platanaceae), em Bento Gonçalves, RS, Brasil. Após isolamento, purificação e caracterização, realizou-se um teste de patogenicidade com lagartas sadias de L. obliqua para corroborar, sua infectividade pelo postulado de Koch. Constatou-se correspondência morfológica e molecular entre o inóculo e o reisolado, comprovando sua patogenicidade a L. obliqua.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

O uso de enzimas como agentes de modificação das propriedades funcionais de proteínas tem se tornado bastante difundido na indústria de alimentos. As proteases, apresentam inúmeras vantagens, principalmente, devido a sua atividade em baixas concentrações e a sua ausência de toxicidade, que faz com que se elimine a necessidade da sua remoção do produto final. O objetivo deste trabalho foi determinar as condições ótimas de produção da protease de Microbacterium sp. kr10, caracterizar e purificar parcialmente a enzima, assim como verificar a sua utilização como agente de modificação das propriedades funcionais da proteína de soja. Através da metodologia de superfície de resposta foram determinadas as condições ótimas de produção da protease, pH de 7,0, temperatura de 25°C e 12,5 g L-1 de farinha de pena (p/v). O padrão proteolítico da enzima tanto no extrato cru quanto na parcialmente purificada indicam que esta é uma metaloprotease, com pH e temperaturas ótimos nas faixas de 6,5 a 7,5, e 45 a 55°C, respectivamente. A atividade enzimática foi totalmente inibida por EDTA, fenantrolina, HgCl2 e CuCl2 e parcialmente inibida por ZnCl2, MnCl2 e SnCl2. A enzima foi parcialmente purificada através de cromatografia de gel filtração e troca iônica resultando num fator de purificação de 250. Um aumento gradativo do grau de hidrólise da proteína de soja foi observado à medida que se aumentou a razão enzima/substrato utilizada, assim como a redução da formação de espuma e o aumento da capacidade emulsificante de uma solução composta pelo hidrolisado de soja e óleo de soja, mesmo sob condições de alta temperatura e alta concentração de sal. Desta forma, esta protease apresenta potencial para aplicação como agente de modificação protéica de proteína de soja isolada.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A caracterização molecular e morfofisiológica de 28 isolados de Metarhizium ssp. foi avaliada por análises de seqüências do espaçador transcrito interno (ITS1 e ITS2), presença de elementos dsRNA e taxa de crescimento e esporulação em diferentes temperaturas e pH. A patogenicidade de 19 isolados do fungo entomopatogênico Metarhizium ssp. foi avaliada para fêmeas ingurgitadas do carrapato Boophilus microplus. As alterações cronológicas durante o processo de infecção Metarhizium anisopliae isolado E6 em B. microplus foi avaliada em detalhe por microscopia óptica e eletrônica de varredura e transmissão. O seqüenciamento do espaçador transcrito interno confirmou a identidade taxonômica dos isolados avaliados como M. anisopliae var. anisopliae ou M. anisopliae var. majus e mostrou que dois isolados (CG291 e CG423), previamente classificados como Metarhizium flavoviride, são pertencentes a M. anisopliae var. anisopliae. Os testes sobre a influência da temperatura e pH no desenvolvimento e esporulação dos isolados evidenciaram que a melhor temperatura de crescimento para a maioria desses foi 28oC e que o crescimento foi ótimo na faixa de pH entre 4 a 9. Os bioensaios mostraram que três isolados (C14, CG47 e CG97) foram altamente patogênicos para fêmeas ingurgitadas de B. microplus sendo tão virulentos quanto o isolado E6, previamente analisado, causando cerca de 90-100% de mortalidade ao 4o dia de infecção. Outros isolados foram menos virulentos ou não mostraram virulência para o carrapato. A presença de dsRNA foi avaliada em 28 isolados e detectada em 21 isolados. Vários padrões de dsRNA foram observados baseados no tamanho molecular analisado por eletroforese em gel de agarose. Nenhuma correlação foi observada entre a presença de dsRNA e a virulência do fungo. As observações microscópicas evidenciaram que o fungo M. anisopliae isolado E6 invade seu hospedeiro por penetração direta da cutícula, sendo que este processo envolveu as etapas de adesão e germinação dos conídios, formação do apressório e penetração do fungo na cutícula do hospedeiro. A adesão e germinação dos conídios na superfície da cutícula se iniciou após 24 h de infecção. Neste mesmo tempo, ocorreu diferenciação do apressório, estrutura que exerce a pressão mecânica durante o processo de penetração, sendo que este processo é facilitado pela ação de enzimas hidrolíticas secretadas pelo fungo. A penetração de algumas hifas ocorreu até 24 h após a infecção do fungo, embora, neste mesmo tempo de infecção, a maioria dos conídios ainda estivesse em processo de germinação. A penetração em massa do fungo foi observada 72 h após a infecção e, após 96 h, as hifas emergiram na superfície da cutícula para originarem novos conídios e assegurarem a perpetuação do fungo. A intensa invasão das hifas nos tecidos adjacentes confirmou a eficácia do isolado E6 na infecção do carrapato B. microplus.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In many countries, fermentation studies regarding the use of bacteria instead of yeasts to reduce the period of alcoholic fermentation have been carried out. In Brazil, all the industrial alcohol production is carried out by yeasts as fermentation microorganisms and little is known about other microorganisms with potential to produce alcohol industrially. Brazil stands out in the energy sector worldwide and thus some institutions have been selecting microorganisms which are more efficient in the alcohol production process. Alcoholic bacteria from species Zymomonas mobilis present technological characteristics with potential to be used for alcoholic fermentation at industrial scale, since it exhibits promising abilities to transform sugars into alcohol and carbon dioxide, at conditions similar to the ones required by yeasts. Zymomonas mobilis is a unique bacteria among the microbial world, with peculiar growth, energy production and response to culture conditions, causing a great interest in scientific, biotechnological and industrial fields. The bacteria's ability to make possible energy production in favor of product formation, respond to physical and chemical environmental manipulation as well as its limited product formation make it an ideal microorganism for the study and development of microbial processes for ethanol production.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Essa invenção se refere ao desenvolvimento de composições com o isolado jab 68 do fungo entomopatogânico metarhizium anisopliae, em peletes de alginato de sádio, e em óleo emulsionável e pó molhável. As composições propostas são usadas no controle da mosca-dos-chifres. As composições em óleo emulsionável e pó molhável também podem ser usadas para o controle do carrapato de bovinos rhipicephalus (boophilus) microplus ou do carrapato de cães rhipicephalus sanguineus e para controle da cigarrinha da folha (mahanarva posticata) e da raiz (mahanarva fimbriolata) da cana-de-açúcar e das pastagens (deois flavopicta).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Pós-graduação em Engenharia e Ciência de Alimentos - IBILCE

Relevância:

10.00% 10.00%

Publicador:

Resumo:

A wild strain of Streptococcus thermophilus isolated from pasteurized milk was evaluated using an experimental model with respect to its adhesion onto stainless steel surfaces and its behaviour when submitted to cleansing and sanification. In milk, the adhesion of the microorganism on to stainless steel surfaces was studied after 6 hours of contact at 45°C with agitation, and after a cleansing process involving cleaning stages with alkaline and acid detergents followed by sanification, in order to evaluate the resistance of the adhered cells. The microorganism adhered to stainless steel surfaces producing a cell load of 10(4) CFU/cm². After alkaline cleansing, no adhered cells were detected but 6 CFU/cm² were still detected on the surfaces after acid cleansing. Cleansing, followed by sanification with sodium hypochlorite, was sufficient to reduce the load of wild S. thermophilus on the stainless steel surfaces to non-detectable levels. The experimental model proved adequate for the study indicating that the wild microorganism S. thermophilus produces biofilms on stainless steel surfaces. Alkaline cleansing remove more that 99.9% of the adhered cells. The few cells adhered on the surface are removed by acid cleansing demonstrating the need to use different steps and types of detergent for efficient cleansing. The best results for the removal of these biofilms are obtained by using alkaline cleansing followed by acid cleaning, this procedure being more efficient when complemented by sanification with sodium hypochlorite.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

This study evaluated in vitro the antibacterial activity of 4 root canal filling materials for primary teeth - zinc oxide and eugenol cement (ZOE), Calen paste thickened with zinc oxide (Calen/ZO), Sealapex sealer and EndoREZ sealer - against 5 bacterial strains commonly found in endodontic infections (Kocuria rhizophila, Enterococcus faecalis, Streptococcus mutans, Escherichia coli and Staphylococcus aureus) using the agar diffusion test (agar-well technique). Calen paste, 1% chlorhexidine digluconate (CHX) and distilled water served as controls. Seven wells per dish were made at equidistant points and immediately filled with the test and control materials. After incubation of the plates at 37oC for 24 h, the diameter of the zones of bacterial growth inhibition produced around the wells was measured (in mm) with a digital caliper under reflected light. Data were analyzed statistically by analysis of variance and Tukey's post-hoc test (?=0.05). There were statistically significant differences (p<0.0001) among the zones of bacterial growth inhibition produced by the different materials against all target microorganisms. K. rhizophila was inhibited more effectively (p<0.05) by ZOE, while Calen/ZO had its highest antibacterial activity against E. faecalis (p<0.05). S. mutans was inhibited by Calen/ZO, Sealapex and ZOE in the same intensity (p>0.05). E. coli was inhibited more effectively (p<0.05) by ZOE, followed by Calen/ZO and Sealapex. Calen/ZO and ZOE were equally effective (p>0.05) against S. aureus, while Sealapex had the lowest antibacterial efficacy (p<0.05) against this microorganism. EndoREZ presented antibacterial activity only against K. rhizophila and S. aureus. The Calen paste and Calen/ZO produced larger zones of inhibition than 1% CHX when the marker microorganism was E faecalis. In conclusion, the in vitro antibacterial activity of the 4 root canal filling materials for primary teeth against bacterial strains commonly found in endodontic infections can be presented in a decreasing order of efficacy as follows: ZOE>Calen/ZO>Sealapex>EndoREZ.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

Aggregatibacter actinomycetemcomitans is an important etiologic agent of the periodontitis and is associated with extra-oral infections. In this study, the detection of the ltxA gene as well as the ltx promoter region from leukotoxic A. actinomycetemcomitans isolated from 50 Brazilian patients with periodontitis and 50 healthy subjects was performed. The leukotoxic activity on HL-60 cells was also evaluated. Leukotoxic activity was determined using a trypan blue exclusion method. The 530 bp deletion in the promoter region was evaluated by PCR using a PRO primer pair. A. actinomycetemcomitans was detected by culture and directly from crude subgingival biofilm by PCR using specific primers. By culture, A. actinomycetemcomitans was detected in nine (18%) of the periodontal patients and one (2%) healthy subject. However, by PCR, this organism was detected in 44% of the periodontal patients and in 16% of the healthy subjects. It was verified a great discrepancy between PCR detection of the ltx operon promoter directly from crude subgingival biofilm and from bacterial DNA. Only one periodontal sample harbored highly leukotoxic A. actinomycetemcomitans. Moreover, biotype II was the most prevalent and no correlation between biotypes and leukotoxic activity was observed. The diversity of leukotoxin expression by A. actinomycetemcomitans suggests a role of this toxin in the pathogenesis of periodontal disease and other infectious diseases.

Relevância:

10.00% 10.00%

Publicador:

Resumo:

As pyometra is recognized as one of the main causes of disease and death in the bitch the purposes of this study were to evaluate microbiological and histopathological aspects of canine pyometra and to research the virulence factors of the E. coli isolates identifying possible risks to human health. The microbiological isolation from the intrauterine contents of 100 dogs with pyometra was carried out and the virulence factors in the E. coli strains were identified using PCR method. This study also consisted of the counting of microorganisms colonies forming units in samples of intrauterine content, tests of antimicrobial susceptibility of the E. coli isolates and the histological examination of the uterus. E. coli was the most prevalent microorganism isolated (76.6%) and 120 strains (79.5%) were positive for sfa, 86 (56.9%) were positive for cnf, 87 (57.6%) were positive for pap, 52 (34.4%) were positive for hly, 51 (33.8%) were positive for iuc and 5 (3.3%) were positive for afa genes. One observed more sensitivity of E. coli to norfloxacin, polimixin B, sulphazotrin, chloranfenicol and enrofloxacin. In 42% of the samples of uterine walls where microorganisms were isolated, the sizes of the areas of the inflammatory responses corresponded to 39-56%. Virulence factors were identified in 98.0% of the strains evaluated, demonstrating a high frequency of potentially pathogenic E. coli. It must be considered that dogs are animals that are living in close proximity to man for thousands of years and have an important role in the transmission of E. coli to other animals and to man.