NEW METHODS FOR DETECTION, SUSCEPTIBILITY TESTING AND BIOFILM ERADICATION OF DIFFICULT ORGANISMS

Aujourd'hui, les problèmes des maladies infectieuses concernent l'émergence d'infections difficiles à traiter, telles que les infections associées aux implants et les infections fongiques invasives chez les patients immunodéprimés. L'objectif de cette thèse était de développer des stratégies pour l'éradication des biofilms bactériens (partie 1), ainsi que d'étudier des méthodes innovantes pour la détection microbienne, pour l'établissement de nouveaux tests de sensibilité (partie 2). Le traitement des infections associées aux implants est difficile car les biofilms bactériens peuvent résister à des niveaux élevés d'antibiotiques. A ce jour, il n'y a pas de traitement optimal défini contre des infections causées par des bactéries de prévalence moindre telles que Enterococcus faecalis ou Propionibacterium acnés. Dans un premier temps, nous avons démontré une excellente activité in vitro de la gentamicine sur une souche de E. faecalis en phase stationnaire de croissance Nous avons ensuite confirmé l'activité de la gentamicine sur un biofilm précoce en modèle expérimental animal à corps étranger avec un taux de guérison de 50%. De plus, les courbes de bactéricidie ainsi que les résultats de calorimétrie ont prouvé que l'ajout de gentamicine améliorait l'activité in vitro de la daptomycine, ainsi que celle de la vancomycine. In vivo, le schéma thérapeutique le plus efficace était l'association daptomycine/gentamicine avec un taux de guérison de 55%. En établissant une nouvelle méthode pour l'évaluation de l'activité des antimicrobiens vis-à-vis de micro-organismes en biofilm, nous avons démontré que le meilleur antibiotique actif sur les biofilms à P. acnés était la rifampicine, suivi par la penicilline G, la daptomycine et la ceftriaxone. Les études conduites en modèle expérimental animal ont confirmé l'activité de la rifampicine seule avec un taux de guérison 36%. Le meilleur schéma thérapeutique était au final l'association rifampicine/daptomycine avec un taux de guérison 63%. Les associations de rifampicine avec la vancomycine ou la levofloxacine présentaient des taux de guérisons respectivement de 46% et 25%. Nous avons ensuite étudié l'émergence in vitro de la résistance à la rifampicine chez P. acnés. Nous avons observé un taux de mutations de 10"9. La caractérisation moléculaire de la résistance chez les mutant-résistants a mis en évidence l'implication de 5 mutations ponctuelles dans les domaines I et II du gène rpoB. Ce type de mutations a déjà été décrit au préalable chez d'autres espèces bactériennes, corroborant ainsi la validité de nos résultats. La deuxième partie de cette thèse décrit une nouvelle méthode d'évaluation de l'efficacité des antifongiques basée sur des mesures de microcalorimétrie isotherme. En utilisant un microcalorimètre, la chaleur produite par la croissance microbienne peut être-mesurée en temps réel, très précisément. Nous avons évalué l'activité de l'amphotéricine B, des triazolés et des échinocandines sur différentes souches de Aspergillus spp. par microcalorimétrie. La présence d'amphotéricine Β ou de triazole retardait la production de chaleur de manière concentration-dépendante. En revanche, pour les échinochandines, seule une diminution le pic de « flux de chaleur » a été observé. La concordance entre la concentration minimale inhibitrice de chaleur (CMIC) et la CMI ou CEM (définie par CLSI M38A), avec une marge de 2 dilutions, était de 90% pour l'amphotéricine B, 100% pour le voriconazole, 90% pour le pozoconazole et 70% pour la caspofongine. La méthode a été utilisée pour définir la sensibilité aux antifongiques pour d'autres types de champignons filamenteux. Par détermination microcalorimétrique, l'amphotéricine B s'est avéré être l'agent le plus actif contre les Mucorales et les Fusarium spp.. et le voriconazole le plus actif contre les Scedosporium spp. Finalement, nous avons évalué l'activité d'associations d'antifongiques vis-à-vis de Aspergillus spp. Une meilleure activité antifongique était retrouvée avec l'amphotéricine B ou le voriconazole lorsque ces derniers étaient associés aux échinocandines vis-à-vis de A. fumigatus. L'association échinocandine/amphotéricine B a démontré une activité antifongique synergique vis-à-vis de A. terreus, contrairement à l'association échinocandine/voriconazole qui ne démontrait aucune amélioration significative de l'activité antifongique. - The diagnosis and treatment of infectious diseases are today increasingly challenged by the emergence of difficult-to-manage situations, such as infections associated with medical devices and invasive fungal infections, especially in immunocompromised patients. The aim of this thesis was to address these challenges by developing new strategies for eradication of biofilms of difficult-to-treat microorganisms (treatment, part 1) and investigating innovative methods for microbial detection and antimicrobial susceptibility testing (diagnosis, part 2). The first part of the thesis investigates antimicrobial treatment strategies for infections caused by two less investigated microorganisms, Enterococcus faecalis and Propionibacterium acnes, which are important pathogens causing implant-associated infections. The treatment of implant-associated infections is difficult in general due to reduced susceptibility of bacteria when present in biofilms. We demonstrated an excellent in vitro activity of gentamicin against E. faecalis in stationary growth- phase and were able to confirm the activity against "young" biofilms (3 hours) in an experimental foreign-body infection model (cure rate 50%). The addition of gentamicin improved the activity of daptomycin and vancomycin in vitro, as determined by time-kill curves and microcalorimetry. In vivo, the most efficient combination regimen was daptomycin plus gentamicin (cure rate 55%). Despite a short duration of infection, the cure rates were low, highlighting that enterococcal biofilms remain difficult to treat despite administration of newer antibiotics, such as daptomycin. By establishing a novel in vitro assay for evaluation of anti-biofilm activity (microcalorimetry), we demonstrated that rifampin was the most active antimicrobial against P. acnes biofilms, followed by penicillin G, daptomycin and ceftriaxone. In animal studies we confirmed the anti-biofilm activity of rifampin (cure rate 36% when administered alone), as well as in combination with daptomycin (cure rate 63%), whereas in combination with vancomycin or levofloxacin it showed lower cure rates (46% and 25%, respectively). We further investigated the emergence of rifampin resistance in P. acnes in vitro. Rifampin resistance progressively emerged during exposure to rifampin, if the bacterial concentration was high (108 cfu/ml) with a mutation rate of 10"9. In resistant isolates, five point mutations of the rpoB gene were found in cluster I and II, as previously described for staphylococci and other bacterial species. The second part of the thesis describes a novel real-time method for evaluation of antifungals against molds, based on measurements of the growth-related heat production by isothermal microcalorimetry. Current methods for evaluation of antifungal agents against molds, have several limitations, especially when combinations of antifungals are investigated. We evaluated the activity of amphotericin B, triazoles (voriconazole, posaconazole) and echinocandins (caspofungin and anidulafungin) against Aspergillus spp. by microcalorimetry. The presence of amphotericin Β or a triazole delayed the heat production in a concentration-dependent manner and the minimal heat inhibition concentration (MHIC) was determined as the lowest concentration inhibiting 50% of the heat produced at 48 h. Due to the different mechanism of action echinocandins, the MHIC for this antifungal class was determined as the lowest concentration lowering the heat-flow peak with 50%. Agreement within two 2-fold dilutions between MHIC and MIC or MEC (determined by CLSI M38A) was 90% for amphotericin B, 100% for voriconazole, 90% for posaconazole and 70% for caspofungin. We further evaluated our assay for antifungal susceptibility testing of non-Aspergillus molds. As determined by microcalorimetry, amphotericin Β was the most active agent against Mucorales and Fusarium spp., whereas voriconazole was the most active agent against Scedosporium spp. Finally, we evaluated the activity of antifungal combinations against Aspergillus spp. Against A. jumigatus, an improved activity of amphotericin Β and voriconazole was observed when combined with an echinocandin. Against A. terreus, an echinocandin showed a synergistic activity with amphotericin B, whereas in combination with voriconazole, no considerable improved activity was observed.

Development of molecular-based techniques for the detection, identification and quantification of food-borne pathogens

La presencia de microorganismos patógenos en alimentos es uno de los problemas esenciales en salud pública, y las enfermedades producidas por los mismos es una de las causas más importantes de enfermedad. Por tanto, la aplicación de controles microbiológicos dentro de los programas de aseguramiento de la calidad es una premisa para minimizar el riesgo de infección de los consumidores. Los métodos microbiológicos clásicos requieren, en general, el uso de pre-enriquecimientos no-selectivos, enriquecimientos selectivos, aislamiento en medios selectivos y la confirmación posterior usando pruebas basadas en la morfología, bioquímica y serología propias de cada uno de los microorganismos objeto de estudio. Por lo tanto, estos métodos son laboriosos, requieren un largo proceso para obtener resultados definitivos y, además, no siempre pueden realizarse. Para solucionar estos inconvenientes se han desarrollado diversas metodologías alternativas para la detección identificación y cuantificación de microorganismos patógenos de origen alimentario, entre las que destacan los métodos inmunológicos y moleculares. En esta última categoría, la técnica basada en la reacción en cadena de la polimerasa (PCR) se ha convertido en la técnica diagnóstica más popular en microbiología, y recientemente, la introducción de una mejora de ésta, la PCR a tiempo real, ha producido una segunda revolución en la metodología diagnóstica molecular, como pude observarse por el número creciente de publicaciones científicas y la aparición continua de nuevos kits comerciales. La PCR a tiempo real es una técnica altamente sensible -detección de hasta una molécula- que permite la cuantificación exacta de secuencias de ADN específicas de microorganismos patógenos de origen alimentario. Además, otras ventajas que favorecen su implantación potencial en laboratorios de análisis de alimentos son su rapidez, sencillez y el formato en tubo cerrado que puede evitar contaminaciones post-PCR y favorece la automatización y un alto rendimiento. En este trabajo se han desarrollado técnicas moleculares (PCR y NASBA) sensibles y fiables para la detección, identificación y cuantificación de bacterias patogénicas de origen alimentario (Listeria spp., Mycobacterium avium subsp. paratuberculosis y Salmonella spp.). En concreto, se han diseñado y optimizado métodos basados en la técnica de PCR a tiempo real para cada uno de estos agentes: L. monocytogenes, L. innocua, Listeria spp. M. avium subsp. paratuberculosis, y también se ha optimizado y evaluado en diferentes centros un método previamente desarrollado para Salmonella spp. Además, se ha diseñado y optimizado un método basado en la técnica NASBA para la detección específica de M. avium subsp. paratuberculosis. También se evaluó la aplicación potencial de la técnica NASBA para la detección específica de formas viables de este microorganismo. Todos los métodos presentaron una especificidad del 100 % con una sensibilidad adecuada para su aplicación potencial a muestras reales de alimentos. Además, se han desarrollado y evaluado procedimientos de preparación de las muestras en productos cárnicos, productos pesqueros, leche y agua. De esta manera se han desarrollado métodos basados en la PCR a tiempo real totalmente específicos y altamente sensibles para la determinación cuantitativa de L. monocytogenes en productos cárnicos y en salmón y productos derivados como el salmón ahumado y de M. avium subsp. paratuberculosis en muestras de agua y leche. Además este último método ha sido también aplicado para evaluar la presencia de este microorganismo en el intestino de pacientes con la enfermedad de Crohn's, a partir de biopsias obtenidas de colonoscopia de voluntarios afectados. En conclusión, este estudio presenta ensayos moleculares selectivos y sensibles para la detección de patógenos en alimentos (Listeria spp., Mycobacterium avium subsp. paratuberculosis) y para una rápida e inambigua identificación de Salmonella spp. La exactitud relativa de los ensayos ha sido excelente, si se comparan con los métodos microbiológicos de referencia y pueden serusados para la cuantificación de tanto ADN genómico como de suspensiones celulares. Por otro lado, la combinación con tratamientos de preamplificación ha resultado ser de gran eficiencia para el análisis de las bacterias objeto de estudio. Por tanto, pueden constituir una estrategia útil para la detección rápida y sensible de patógenos en alimentos y deberían ser una herramienta adicional al rango de herramientas diagnósticas disponibles para el estudio de patógenos de origen alimentario.

Rapid microbiological detection method based on ultrasonic instrumentation

Los métodos de detección rápida de microorganismos se están convirtiendo en una herramienta esencial para el control de calidad en el área de la biotecnología, como es el caso de las industrias de alimentos y productos farmacéuticos y bioquímicos. En este escenario, el objetivo de esta tesis doctoral es desarrollar una técnica de inspección rápida de microoganismos basada en ultrasonidos. La hipótesis propuesta es que la combinación de un dispositivo ultrasónico de medida y un medio líquido diseñado específicamente para producir y atrapar burbujas, pueden constituir la base de un método sensible y rápido de detección de contaminaciones microbianas. La técnica presentada es efectiva para bacterias catalasa-positivas y se basa en la hidrólisis del peróxido de hidrógeno inducida por la catalasa. El resultado de esta reacción es un medio con una creciente concentración de burbujas. Tal medio ha sido estudiado y modelado desde el punto de vista de la propagación ultrasónica. Las propiedades deducidas a partir del análisis cinemático de la enzima se han utilizado para evaluar el método como técnica de inspección microbiana. En esta tesis, se han investigado aspectos teóricos y experimentales de la hidrólisis del peróxido de hidrógeno. Ello ha permitido describir cuantitativamente y comprender el fenómeno de la detección de microorganismos catalasa-positivos mediante la medida de parámetros ultrasónicos. Más concretamente, los experimentos realizados muestran cómo el oxígeno que aparece en forma de burbujas queda atrapado mediante el uso de un gel sobre base de agar. Este gel fue diseñado y preparado especialmente para esta aplicación. A lo largo del proceso de hidrólisis del peróxido de hidrógeno, se midió la atenuación de la onda y el “backscattering” producidos por las burbujas, utilizando una técnica de pulso-eco. Ha sido posible detectar una actividad de la catalasa de hasta 0.001 unidades/ml. Por otra parte, este estudio muestra que por medio del método propuesto, se puede lograr una detección microbiana para concentraciones de 105 células/ml en un periodo de tiempo corto, del orden de unos pocos minutos. Estos resultados suponen una mejora significativa de tres órdenes de magnitud en comparación con otros métodos de detección por ultrasonidos. Además, la sensibilidad es competitiva con modernos y rápidos métodos microbiológicos como la detección de ATP por bioluminiscencia. Pero sobre todo, este trabajo muestra una metodología para el desarrollo de nuevas técnicas de detección rápida de bacterias basadas en ultrasonidos. ABSTRACT In an industrial scenario where rapid microbiological methods are becoming essential tools for quality control in the biotechnological area such as food, pharmaceutical and biochemical; the objective of the work presented in this doctoral thesis is to develop a rapid microorganism inspection technique based on ultrasounds. It is proposed that the combination of an ultrasonic measuring device with a specially designed liquid medium, able to produce and trap bubbles could constitute the basis of a sensitive and rapid detection method for microbial contaminations. The proposed technique is effective on catalase positive microorganisms. Well-known catalase induced hydrogen peroxide hydrolysis is the fundamental of the developed method. The physical consequence of the catalase induced hydrogen peroxide hydrolysis is an increasingly bubbly liquid medium. Such medium has been studied and modeled from the point of view of ultrasonic propagation. Properties deduced from enzyme kinematics analysis have been extrapolated to investigate the method as a microbial inspection technique. In this thesis, theoretical and experimental aspects of the hydrogen peroxide hydrolysis were analyzed in order to quantitatively describe and understand the catalase positive microorganism detection by means of ultrasonic measurements. More concretely, experiments performed show how the produced oxygen in form of bubbles is trapped using the new gel medium based on agar, which was specially designed for this application. Ultrasonic attenuation and backscattering is measured in this medium using a pulse-echo technique along the hydrogen peroxide hydrolysis process. Catalase enzymatic activity was detected down to 0.001 units/ml. Moreover, this study shows that by means of the proposed method, microbial detection can be achieved down to 105 cells/ml in a short time period of the order of few minutes. These results suppose a significant improvement of three orders of magnitude compared to other ultrasonic detection methods for microorganisms. In addition, the sensitivity reached is competitive with modern rapid microbiological methods such as ATP detection by bioluminescence. But above all, this work points out a way to proceed for developing new rapid microbial detection techniques based on ultrasound.

Characterization of fecal contamination targeting 16S rRNA bacteroides molecular markers in the Santa Cruz River, Arizona

Understanding the origins, transport and fate of contamination is essential to effective management of water resources and public health. Individuals and organizations with management responsibilities need to understand the risks to ecosystems and to humans from contact with contamination. Managers also need to understand how key contaminants vary over time and space in order to design and prioritize mitigation strategies. Tumacacori National Historic Park (NHP) is responsible for management of its water resources for the benefit of the park and for the health of its visitors. The existence of microbial contaminants in the park poses risks that must be considered in park planning and operations. The water quality laboratory at the Maricopa Agricultural Center (in collaboration with stakeholder groups and individuals located in the ADEQ-targeted watersheds) identified biological changes in surface water quality in impaired reaches rivers to determine the sources of Escherichia coli (E. coli); bacteria utilizing innovative water quality microbial/bacterial source tracking methods. The end goal was to support targeted watershed groups and ADEQ towards E. coli reductions. In the field monitoring was conducted by the selected targeted watershed groups in conjunction with The University of Arizona Maricopa Agricultural Center Water Quality Laboratory. This consisted of collecting samples for Bacteroides testing from multiple locations on select impaired reaches, to determine contamination resulting from cattle, human recreation, and other contributions. Such testing was performed in conjunction with high flow and base flow conditions in order to accurately portray water quality conditions and variations. Microbial monitoring was conducted by The University of Arizona Water Quality Laboratory at the Maricopa Agricultural Center using genetic typing to differentiate among two categories of Bacteroides: human and all (total). Testing used microbial detection methodologies and molecular source tracking techniques.^

Detection of lateral gene transfer among microbial genomes

An increasingly comprehensive assessment is being developed of the extent and potential significance of lateral gene transfer among microbial genomes. Genomic sequences can be identified as being of putatively lateral origin by their unexpected phyletic distribution, atypical sequence composition, differential presence or absence in closely related genomes, or incongruent phylogenetic trees. These complementary approaches sometimes yield inconsistent results. Not only more data but also quantitative models and simulations are needed urgently.

Improved detection of microbial ureteral stent colonisation by sonication.

PURPOSE: The diagnosis of microbial ureteral stent colonisation (MUSC) is difficult, since routine diagnostic techniques do not accurately detect microorganisms embedded in biofilms. New methods may improve diagnostic yield and understanding the pathophysiology of MUSC. The aim of the present study was to evaluate the potential of sonication in the detection of MUSC and to identify risk factors for device colonisation. METHODS: Four hundred and eight polyurethane ureteral stents of 300 consecutive patients were prospectively evaluated. Conventional urine culture (CUC) was obtained prior to stent placement and device removal. Sonication was performed to dislodge adherent microorganisms. Data of patient sex and age, indwelling time and indication for stent placement were recorded. RESULTS: Sonicate-fluid culture detected MUSC in 36%. Ureteral stents inserted during urinary tract infection (UTI) were more frequently colonised (59%) compared to those placed in sterile urine (26%; P < 0.001). Female sex (P < 0.001) and continuous stenting (P < 0.005) were significant risk factors for MUSC; a similar trend was observed in patients older than 50 years (P = 0.16). MUSC and indwelling time were positively correlated (P < 0.005). MUSC was accompanied by positive CUC in 36%. Most commonly isolated microorganisms were Coagulase-negative staphylococci (18.3%), Enterococci (17.9%) and Enterobacteriaceae (16.9%). CONCLUSIONS: Sonication is a promising approach in the diagnosis of MUSC. Significant risk factors for MUSC are UTI at the time of stent insertion, female sex, continuous stenting and indwelling time. CUC is a poor predictor of MUSC. The clinical relevance of MUSC needs further evaluation to classify isolated microorganism properly as contaminants or pathogens.

Detection of mixed microbial biofilms on central venous catheters removed from Intensive care Unit Patients

Cateteres venosos centrais inseridos em pacientes internados em unidade de terapia intensiva foram avaliados por métodos microbiológicos (cultura semi-quantitativa) e microscopia eletrônica de varredura a fim de detectar adesão microbiana e correlacionar com a cultura de sangue. Durante o período de estudo, foram avaliados 59 pacientes com cateter venoso central. A idade dos pacientes, sexo, sítio de inserção e tempo de permanência do cateter foram anotados. O cateter era de poliuretano não tunelizado e de único lúmen. O sangue para cultura foi coletado no momento da remoção do cateter. de 63 pontas de cateteres, 30 (47,6%) foram colonizadas e a infecção encontrada em 5 (23,8%) cateteres. A infecção foi mais prevalente em 26 pacientes (41,3%) com cateteres inseridos em veia subclávia do que nos 3 (3,2%) inseridos em veia jugular. A infecção foi observada com mais freqüência em cateteres com tempo de permanência maior do que sete dias. Os microrganismos isolados incluíram 32 estafilococos coagulase-negativa (29,7%), 61 bactérias Gram-negativas (52,9%), 9 estafilcocos coagulase-positiva (8,3%) e 3 leveduras (2,7%). Como agentes causais de infecções em unidade de terapia intensiva foram isolados E. aerogenes, P. aeruginosa, A. baumannii. Os antimicrobianos com maior atividade in vitro contra as bactérias Gram-negativas foram o imipenem e contra as Gram-positivas vancomicina, cefepime, penicilina, rifampicina e tetraciclina. As análises por microscopia eletrônica de varredura revelaram biofilmes sobre a superfície de todos os cateteres examinados.

Molecular detection of in-vivo microbial contamination of metallic orthodontic brackets by checkerboard DNA-DNA hybridization

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Molecular detection of in-vivo microbial contamination of metallic orthodontic brackets by checkerboard DNA-DNA hybridization

Introduction: Knowing the microbiota that colonizes orthodontic appliances is important for planning strategies and implementing specific preventive measures during treatment. The purpose of this clinical trial was to evaluate in vivo the contamination of metallic orthodontic brackets with 40 DNA probes for different bacterial species by using the checkerboard DNA-DNA hybridization (CDDH) technique. Methods: Eighteen patients, 11 to 29 years of age having fixed orthodontic treatment, were enrolled in the study. Each subject had 2 new metallic brackets bonded to different premolars in a randomized manner. After 30 days, the brackets were removed and processed for analysis by CDDH. Data on bacterial contamination were analyzed descriptively and with the Kruskal-Wallis and Dunn post tests (alpha = 0.05). Forty microbial species (cariogenic microorganisms, bacteria of the purple, yellow, green, orange complexes, "red complex + Treponema socranskii," and the cluster of Actinomyces) were assessed. Results: Most bacterial species were present in all subjects, except for Streptococcus constellatus, Campylobacter rectus, Tannerella forsythia, T socranskii, and Lactobacillus acidophillus (94.4%), Propionibacterium acnes I and Eubacterium nodatum (88.9%), and Treponema denticola (77.8%). Among the cariogenic microorganisms, Streptococcus mutans and Streptococcus sobrinus were found in larger numbers than L acidophillus and Lactobacillus casei (P < 0.001). The periodontal pathogens of the orange complex were detected in larger numbers than those of the "red complex + T socranskii" (P < 0.0001). Among the bacteria not associated with specific pathologies, Veillonella parvula (purple complex) was the most frequently detected strain (P < 0.0001). The numbers of yellow and green complex bacteria and the cluster of Actinomyces were similar (P > 0.05). Conclusions: Metallic brackets in use for 1 month were multi-colonized by several bacterial species, including cariogenic microorganisms and periodontal pathogens, reinforcing the need for meticulous oral hygiene and additional preventive measures to maintain oral health in orthodontic patients. (Am J Orthod Dentofacial Orthop 2012;141:24-9)

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Molecular detection and differentiation of Brazilian and African isolates of the entomopathogen Neozygites tanajoae (Entomophthorales: Neozygitaceae) with PCR using specific primers

Neozygites tanajoae is an entomopathogenic fungus which has been used for biocontrol of the cassava green mite (Mononychellus tanajoa, CGM) in Africa. Establishment and dispersal of Brazilian isolates which have been introduced into some African countries in recent years to improve CGM control was followed with specific PCR assays. Two primer pairs, NEOSSU_F/NEOSSU_R and 8DDC_F/8DDC_R, were used to differentiate isolates collected from several locations in Brazil and from three countries in Africa, Benin, Ghana and Tanzania. The first primer pair enabled the species-specific detection of Neozygites tanajoae, while the second differentiated the Brazilian isolates from those of other geographical origin. PCR assays were designed for detection of fungal DNA in the matrix of dead infested mites since N. tanajoae is difficult to isolate and culture on selective artificial media. Our results show that all isolates (Brazilian and African) that sporulated on mummified mites were amplified with the first primer pair confirming their Neozygites tanajoae identity. The second pair amplified DNA from all the Brazilian isolates, but did not amplify any DNA samples from the African isolates. None of the two primers showed amplification neither from any of the non-sporulating mite extracts nor from the dead uninfected mites used as negative controls. We confirmed that the two primer pairs tested are suitable for the detection and differential identification of N. tanajoae isolates from Brazil and Africa and that they are useful to monitor the establishment and spread of the Brazilian isolates of N. tanajoae introduced into Benin or into other African countries for improvement of CGM biocontrol.

Molecular assays for detection of human metapneumovirus

The recent description of the respiratory pathogen human metapneumovirus (hMPV) has highlighted a deficiency in current diagnostic techniques for viral agents associated with acute lower respiratory tract infections. We describe two novel approaches to the detection of viral RNA by use of reverse transcriptase PCR (RT-PCR). The PCR products were identified after capture onto a solid-phase medium by hybridization with a sequence-specific, biotinylated oligonucleotide probe. The assay was applied to the screening of 329 nasopharyngeal aspirates sampled from patients suffering from respiratory tract disease. These samples were negative for other common microbial causes of respiratory tract disease. We were able to detect hMPV sequences in 32 (9.7%) samples collected from Australian patients during 2001. To further reduce result turnaround times we designed a fluorogenic TaqMan oligoprobe and combined it with the existing primers for use on the LightCycler platform. The real-time RT-PCR proved to be highly reproducible and detected hMPV in an additional 6 out of 62 samples (9.6%) tested during the comparison of the two diagnostic approaches. We found the real-time RT-PCR to be the test of choice for future investigation of samples for hMPV due to its speed, reproducibility, specificity, and sensitivity.

Fungal and microbial volatile organic compounds exposure assessment in a waste sorting plant

In the management of solid waste, pollutants over a wide range are released with different routes of exposure for workers. The potential for synergism among the pollutants raises concerns about potential adverse health effects, and there are still many uncertainties involved in exposure assessment. In this study, conventional (culture-based) and molecular real-time polymerase chain reaction (RTPCR) methodologies were used to assess fungal air contamination in a waste-sorting plant which focused on the presence of three potential pathogenic/toxigenic fungal species: Aspergillus flavus, A. fumigatus, and Stachybotrys chartarum. In addition, microbial volatile organic compounds (MVOC) were measured by photoionization detection. For all analysis, samplings were performed at five different workstations inside the facilities and also outdoors as a reference. Penicillium sp. were the most common species found at all plant locations. Pathogenic/toxigenic species (A. fumigatus and S. chartarum) were detected at two different workstations by RTPCR but not by culture-based techniques. MVOC concentration indoors ranged between 0 and 8.9 ppm (average 5.3 ± 3.16 ppm). Our results illustrated the advantage of combining both conventional and molecular methodologies in fungal exposure assessment. Together with MVOC analyses in indoor air, data obtained allow for a more precise evaluation of potential health risks associated with bioaerosol exposure. Consequently, with this knowledge, strategies may be developed for effective protection of the workers.