995 resultados para Microbial control


Relevância:

100.00% 100.00%

Publicador:

Resumo:

Cells and cell-free solutions of the culture filtrate of the bacterial symbiont, Xenorhabdus nematophila taken from the entomopathogenic nematode Steinernema carpocapsae in aqueous broth suspensions were lethal to larvae of the diamondback moth Plutella xylostella. Their application on leaves of Chinese cabbage indicated that the cells can penetrate into the insects in the absence of the nematode vector. Cell-free solutions containing metabolites were also proved as effective as bacterial cells suspension. The application of aqueous suspensions of cells of X. nematophila or solutions containing its toxic metabolites to the leaves represents a possible new strategy for controlling insect pests on foliage.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The photodynamic therapy (PDT) is a combination of using a photosensitizer agent, light and oxygen that can cause oxidative cellular damage. This technique is applied in several cases, including for microbial control. The most extensively studied light sources for this purpose are lasers and LED-based systems. Few studies treat alternative light sources based PDT. Sources which present flexibility, portability and economic advantages are of great interest. In this study, we evaluated the in vitro feasibility for the use of chemiluminescence as a PDT light source to induce Staphylococcus aureus reduction. The Photogem (R) concentration varied from 0 to 75 mu g/ml and the illumination time varied from 60 min to 240 min. The long exposure time was necessary due to the low irradiance achieved with chemiluminescence reaction at mu W/cm(2) level. The results demonstrated an effective microbial reduction of around 98% for the highest photosensitizer concentration and light dose. These data suggest the potential use of chemiluminescence as a light source for PDT microbial control, with advantages in terms of flexibility, when compared with conventional sources. (C) 2011 Elsevier B.V. All rights reserved.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Relevância:

100.00% 100.00%

Publicador:

Resumo:

"August 1998" -- Cover.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Fungal entomopathogens have been used more frequently than other types of pathogens for classical biological control. Among 136 programs using different groups of arthropod pathogens, 49.3% have introduced fungal pathogens (including both the traditional fungi and microsporidia). The most commonly introduced species was Metarhizium anisopliae (Metschnikoff) Sorokin, with 13 introductions, followed by Entomophaga maimaiga Humber, Shimazu & Soper, which was released seven times. The majority of introduction programs have focused on controlling invasive species of insects or mites (70.7%) rather than on native hosts (29.4%). Almost half of the introductions of traditional fungi targeted species of Hemiptera and 75% of the microsporidia introduced have been introduced against lepidopteran species. The United States was the country where most introductions of fungi took place (n = 24). From 1993 to 2007, no arthropod pathogens were released in the US due to the rigorous regulatory structure, but in 2008 two species of microsporidia were introduced against the gypsy moth, Lymantria dispar (L.). Establishment of entomopathogenic fungi in programs introducing traditional fungi was 32.1% and establishment was 50.0% for programs introducing microsporidia. In some programs, releases have resulted in permanent successful establishment with no non-target effects. In summary, classical biological control using fungal entomopathogens can provide a successful and environmentally friendly avenue for controlling arthropod pests, including the increasing numbers of invasive non-native species.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Novel nonthermal processes, such as high hydrostatic pressure (HHP), pulsed electric fields (PEFs), ionizing radiation and ultrasonication, are able to inactivate microorganisms at ambient or sublethal temperatures. Many of these processes require very high treatment intensities, however, to achieve adequate microbial destruction in low-acid foods. Combining nonthermal processes with conventional preservation methods enhances their antimicrobial effect so that lower process intensities can be used. Combining two or more nonthermal processes can also enhance microbial inactivation and allow the use of lower individual treatment intensities. For conventional preservation treatments, optimal microbial control is achieved through the hurdle concept, with synergistic effects resulting from different components of the microbial cell being targeted simultaneously. The mechanisms of inactivation by nonthermal processes are still unclear; thus, the bases of synergistic combinations remain speculative. This paper reviews literature on the antimicrobial efficiencies of nonthermal processes combined with conventional and novel nonthermal technologies. Where possible, the proposed mechanisms of synergy is mentioned. (C) 2003 Elsevier Science B.V. All rights reserved.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The consumption of natural products has become a public health problem, since these medicinal teas are prepared using natural plants without an effective hygienic and sanitary control. The aim of this study was to assess the effects of gamma radiation, on the microbial burden of two medicinal plants: Melissa officinalis and Lippia citriodora. Dried samples of the two plants were irradiated at a Co-60 experimental equipment. The applied gamma radiation doses were 1, 3, and 5 kGy at a dose rate of 1.34 kGy/h. Non-irradiated samples followed all the experiments. Bacterial and fungal counts were assessed before and after irradiation by membrane filtration method. Challenging tests with Escherichia coli were performed in order to evaluate the disinfection efficiency of gamma radiation treatment. Characterization of M. officinalis and L. citriadora microbiota indicated an average bioburden value of 102CFU/g. The inactivation studies of the bacterial mesophilic population of both dried plants pointed out to a one log reduction of microbial load after irradiation at 5 kGy. Regarding the fungal population, the initial load of 30 CFU/g was only reduced by 0.5 log by an irradiation dose of 5 kGy. The dynamics with radiation doses of plants microbial population’s phenotypes indicated the prevalence of gram-positive rods for M. officinalis before and after irradiation, and the increase of the frequency of gram-negative rods with irradiation for L. citriadora. Among fungal population of both plants, Mucor, Neoscytalidium, Aspergillus and Alternaria were the most isolated genera. The results obtained in the challenging tests with E. coli on plants pointed out to an inactivation efficiency of 99.5% and 99.9% to a dose of 2 kGy, for M.officinalis and L. citriadora, respectively. The gamma radiation treatment can be a significant tool for the microbial control in medicinal plants.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Few microorganisms are commercially available for use against white grubs (larvae of Scarabaeidae). Entomopathogenic bacteria, particularly Bacillus popilliae, have been used the longest for white grub suppression. Other bacteria, namely B. thuringiensis and Serratia spp. offer promise for future control. This papes examines two genera of bacteria (Bacillus and Serratia) from the historical and current perspective. Bacillus popilliae, the firs microbial control agent registered in the United States, has a long history of use in suppressing populations of the Japanese beetle, Popillia japonica. However, lack of in vitro production and the slow and sporadic nature of its activity, severely limits its utilization. B. thuringiensis, the most widely used microbial pesticide, has not been used for scarab, control. However, strains with scarab activity have recently been discovered. Scarab larvae have been collected in the United States with signs and symptoms similar to those characteristic of amber disease (caused by Serratia entomophila) in the New Zealand grass grub, Costelytra zealandica. A total of 147 bacteria have been obtained from the digestive tracts of larvae of the Japanese beetle and masked chafers, Cyclocephala spp., as well as from larvae and soil collected in Japan and China. Seventy five of these have been identified as Serratia spp. Most (40) of the remaining bacteria are in the genus Enterobacter. A majority of the bacteria (73) and of the Serratia (38) came from P. japonica.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Thrips are reported as important pests on table grapes in United States and several countries of Europe. Damage caused by thrips, particulary Frankliniella occidentalis, was observed on niagara table grape crop in Limeira-SP, Brazil. During the blooming period, high thrips densities were observed feeding on pollen and small berries. The symptoms left were more visible after the development of the berries and were characterized by dark scars and suberized surface on berries, sometimes causing the berry to crack, and the seed to prolapse. The effect of insecticides thiacloprid or methiocarb, associated or not with the entomopathogenic fungus Metarhizium anisopliae were evaluated during the blooming period. For evaluation of thrips damage on fruits, the treatments were applied three additional times, 7, 14 and 21 days after the first application. The treatments were: a) M. anisopliae (strain 1037) 1x10(7) conidia/mL; b) thiacloprid 20mL/100L; c-d) methiocarb 100 and 150mL/100L; e) methiocarb 100mL/100L + M. anisopliae 1x10(7) conidia/mL. Only methiocarb, associated or not with the fungus, was effective in reducing thrips infestation, and no phytotoxic damage was observed. The efficiency of methiocarb 150mL/100L and the insecticide associated with the fungus for the control of the thrips population was 84.2 and 95.5%, respectively. In both cases, there was a reduction of approximately 70% in the number of berries with scars symptoms. For control of thrips on table grapes, chemical insecticides associated or not with M. anisopliae should be applied during the blooming period of the crop.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Neozygites tanajoae is an entomopathogenic fungus which has been used for biocontrol of the cassava green mite (Mononychellus tanajoa, CGM) in Africa. Establishment and dispersal of Brazilian isolates which have been introduced into some African countries in recent years to improve CGM control was followed with specific PCR assays. Two primer pairs, NEOSSU_F/NEOSSU_R and 8DDC_F/8DDC_R, were used to differentiate isolates collected from several locations in Brazil and from three countries in Africa, Benin, Ghana and Tanzania. The first primer pair enabled the species-specific detection of Neozygites tanajoae, while the second differentiated the Brazilian isolates from those of other geographical origin. PCR assays were designed for detection of fungal DNA in the matrix of dead infested mites since N. tanajoae is difficult to isolate and culture on selective artificial media. Our results show that all isolates (Brazilian and African) that sporulated on mummified mites were amplified with the first primer pair confirming their Neozygites tanajoae identity. The second pair amplified DNA from all the Brazilian isolates, but did not amplify any DNA samples from the African isolates. None of the two primers showed amplification neither from any of the non-sporulating mite extracts nor from the dead uninfected mites used as negative controls. We confirmed that the two primer pairs tested are suitable for the detection and differential identification of N. tanajoae isolates from Brazil and Africa and that they are useful to monitor the establishment and spread of the Brazilian isolates of N. tanajoae introduced into Benin or into other African countries for improvement of CGM biocontrol.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Several factors make the local production of Bacillus thuringiensis (Bt) highly appropriate for pest control in developing nations. Bt can be cheaply produced on a wide variety of low cost, organic substrates. Local production results in considerable savings in hard currency which otherwise would be spent on importation of chemical and biological insecticides. The use of Bt in Brazil has been limited in comparison with chemical insecticides. Although Bt is imported, some Brazilian researchers have been working on its development and production. Fermentation processes (submerged and semi-solid) were applied, using by-products from agro-industries. As the semi-solid fermentation process demonstrated to be interesting for Bt endotoxins production, it could be adopted for small scale local production. Although promising results had been achieved, national products have not been registered due to the absence of a specific legislation for biological products. Effective actions are being developed in order to solve this gap. Regardless of the biocontrol agents being considered atoxic and harmless to the environment, information related to direct and indirect effects of microbials are still insufficient in many cases. The risk analysis of the use of microbial control agents is of upmost importance nowadays, and is also discussed.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

La finalitat del projecte ha estat desenvolupar un espai virtual teòric-pràctic per a l’aprenentatge de la Microbiologia. Aquest espai virtual, basat en l'aprenentatge a través de problemes, s’ha anomenat “Microbiologia Interactiva” i proposa a l’alumne les següents àrees temàtiques: Introducció a les tècniques de la Microbiologia; Estructura i funció de la cèl.lula microbiana; Creixement i control microbià; Microbiologia molecular; Fisiologia i metabolisme microbians; Virologia; Ecologia Microbiana; Diversitat microbiana. Per a cada temàtica s’han definit unes competències a assolir a través de la resolució de problemes teòrics o pràctics. En aquest darrer cas, se li proposa a l’alumne que entri en el laboratori virtual per a la resolució dels casos pràctics plantejats. A més, per a la resolució dels problemes, l’alumne disposa d’un seguit de recursos per a cada temàtica. Finalment, també s’inclouen activitats de relació i d’ampliació per tal d’estimular la discussió, l’esperit crìtic, el treball en grup i la recerca bibliogràfica. A més, per tal de facilitar el seu ús, el web disposa també d'un tutorial. El web “Microbiologia Interactiva” es va introduir de forma pilat en l’ensenyament de l'assignatura de Microbiologia de la Llicenciatura de Biologia i de la de Microbiologia I de la llicenciatura de Biotecnologia de la Universitat Autònoma de Barcelona (UAB) durant el curs 2007-08. Al llarg d'aquest curs es va valorar la seva utilitat i acceptació per part dels alumnes mitjançant enquestes. Els bons resultats obtinguts van aconsellar que aquesta eina fora ja utilitzada en totes les assignatures generals de Microbiologia de les llicenciatures de Biologia, Biotecnologia, Bioquímica, Química, Enginyeria Química, Ciències Ambientals i Ciència i Tecnologia dels Aliments de la UAB. Actualment el web s’està també utilitzant amb molt bons resultats a les assignatures de Microbiologia dels nous graus que ofereix la Facultat de Biociències de la UAB. Així doncs, en aquest projecte s’han assolit amb escreix els objectius previstos. Es pot consultar el web desenvolupat a l’adreça http://microbiologia.uab.cat//Microbiologia_Interactiva_Web/.