956 resultados para Microbial colonisation


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Central venous catheters have become an integral part of patient management however they are associated with many complications including infection. Despite efforts being made to reduce the incidence of such infect ions the problem continues to increase and has resource implications for the Health Service. Studies relating to the source of microorganisms causing CVC-associated infection, the cost of such infections and the efficacy of an antimicrobial catheter have been undertaken. Thirty patients who required a CVC as part of their medical management and underwent cardiac surgery had the distal tips of their catheters sampled whilst in situ. Sampling took place within 1 h of catheter placement. Bacteria were isolated from 16% of the catheter distal tips sampled in situ. The guidewires used to insert the devices were also contaminated (50%). When CVC were inserted via a protective sheath, avoiding contact with the skin. the incidence of microbial contamination was reduced. These findings suggest that despite rigorous skin disinfection and strict aseptic technique, viable microorganisms are impacted onto the distal tip of CVC during the insertion procedure. Needleless intravascular access devices have been introduced in order to reduce the incidence of need1estick injury. However, it was unclear whether such connectors would act as a portal of entry for microorganisms to CVC. The efficacy of these devices was investigated. Within the controlled laboratory environment it was demonstrated that needleless devices, when challenged with microorganisms, did not allow the passage of microbes when flu id was injected. This therefore suggested that the devices should not increase the risk of catheter colonisation. When used in clinical practice however microbial contamination of the needleless connectors was 55 % in comparison to the routinely used luer connectors (23%). The cost of infections associated with CVC was determined. Twenty patients catheterised with a CVC designed for long term use who were admitted to hospital with a presumptive diagnosis of catheter-related infection were studied. The treatment given specifically for this infection was costed. The mean cost of such an infection was £ 1781.81. Throughout the UK this may amount to £1.565.906 per annum. The cost of infections associated with CVC designed for short term use was estimated to be between 5 and 7 million pounds per annum in the UK. In an attempt to reduce both the incidence and cost of catheter- related infection antimicrobial CVC have been developed. The efficacy of a novel polyurethane CVC impregnated on both the internal and external catheter surface with the quaternary ammonium compound benzalkonium chloride was investigated. Eighty eight patients received an antimicrobial catheter and 78 patients a conventional polyurethane CVC. The anti-microbial CVC resulted in a reduction in microbial colonisation of the external and internal polymer surfaces as compared to the control device. The observed reduction in microbial colonisation with the anti-microbial CVC may decrease the likelihood of subsequent infection offering a useful approach to the prevention of catheter-related infections.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Studies on hacking have typically focused on motivational aspects and general personality traits of the individuals who engage in hacking; little systematic research has been conducted on predispositions that may be associated not only with the choice to pursue a hacking career but also with performance in either naïve or expert populations. Here, we test the hypotheses that two traits that are typically enhanced in autism spectrum disorders—attention to detail and systemizing—may be positively related to both the choice of pursuing a career in information security and skilled performance in a prototypical hacking task (i.e., crypto-analysis or code-breaking). A group of naïve participants and of ethical hackers completed the Autism Spectrum Quotient, including an attention to detail scale, and the Systemizing Quotient (Baron-Cohen et al., 2001, 2003). They were also tested with behavioral tasks involving code-breaking and a control task involving security X-ray image interpretation. Hackers reported significantly higher systemizing and attention to detail than non-hackers. We found a positive relation between self-reported systemizing (but not attention to detail) and code-breaking skills in both hackers and non-hackers, whereas attention to detail (but not systemizing) was related with performance in the X-ray screening task in both groups, as previously reported with naïve participants (Rusconi et al., 2015). We discuss the theoretical and translational implications of our findings.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

PURPOSE: The diagnosis of microbial ureteral stent colonisation (MUSC) is difficult, since routine diagnostic techniques do not accurately detect microorganisms embedded in biofilms. New methods may improve diagnostic yield and understanding the pathophysiology of MUSC. The aim of the present study was to evaluate the potential of sonication in the detection of MUSC and to identify risk factors for device colonisation. METHODS: Four hundred and eight polyurethane ureteral stents of 300 consecutive patients were prospectively evaluated. Conventional urine culture (CUC) was obtained prior to stent placement and device removal. Sonication was performed to dislodge adherent microorganisms. Data of patient sex and age, indwelling time and indication for stent placement were recorded. RESULTS: Sonicate-fluid culture detected MUSC in 36%. Ureteral stents inserted during urinary tract infection (UTI) were more frequently colonised (59%) compared to those placed in sterile urine (26%; P < 0.001). Female sex (P < 0.001) and continuous stenting (P < 0.005) were significant risk factors for MUSC; a similar trend was observed in patients older than 50 years (P = 0.16). MUSC and indwelling time were positively correlated (P < 0.005). MUSC was accompanied by positive CUC in 36%. Most commonly isolated microorganisms were Coagulase-negative staphylococci (18.3%), Enterococci (17.9%) and Enterobacteriaceae (16.9%). CONCLUSIONS: Sonication is a promising approach in the diagnosis of MUSC. Significant risk factors for MUSC are UTI at the time of stent insertion, female sex, continuous stenting and indwelling time. CUC is a poor predictor of MUSC. The clinical relevance of MUSC needs further evaluation to classify isolated microorganism properly as contaminants or pathogens.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Arbuscular mycorrhizal fungi (AMF) are symbiotic soil fungi that are intimately associated with the roots of the majority of land plants. They colonise the interior of the roots and the hyphae extend into the soil. It is well known that bacterial colonisation of the rhizosphere can be crucial for many pathogenic as well as symbiotic plant-microbe interactions. However, although bacteria colonising the extraradical AMF hyphae (the hyphosphere) might be equally important for AMF symbiosis, little is known regarding which bacterial species would colonise AMF hyphae. In this study, we investigated which bacterial communities might be associated with AMF hyphae. As bacterial-hyphal attachment is extremely difficult to study in situ, we designed a system to grow AMF hyphae of Glomus intraradices and Glomus proliferum and studied which bacteria separated from an agricultural soil specifically attach to the hyphae. Characterisation of attached and non-attached bacterial communities was performed using terminal restriction fragment length polymorphism and clone library sequencing of 16S ribosomal RNA (rRNA) gene fragments. For all experiments, the composition of hyphal attached bacterial communities was different from the non-attached communities, and was also different from bacterial communities that had attached to glass wool (a non-living substratum). Analysis of amplified 16S rRNA genes indicated that in particular bacteria from the family of Oxalobacteraceae were highly abundant on AMF hyphae, suggesting that they may have developed specific interactions with the fungi.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Research has clarified the properties required for polymers that resist bacterial colonisation for use in medical devices. The increase in antibiotic-resistant microorganisms has prompted interest in the use of silver as an antimicrobial agent. Silver-based polymers can protect the inner and outer surfaces of devices against the attachment of microorganisms. Thus, this review focuses on the mechanisms of various silver forms as antimicrobial agents against different microorganisms and biofilms as well as the dissociation of silver ions and the resulting reduction in antimicrobial efficacy for medical devices. This work suggests that the characteristics of released silver ions depend on the nature of the silver antimicrobial used and the polymer matrix. In addition, the elementary silver, silver zeolite and silver nanoparticles, used in polymers or as coatings could be used as antimicrobial biomaterials for a variety of promising applications. (C) 2009 Elsevier B. V. and the International Society of Chemotherapy. All rights reserved.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The inflammasome is a complex of proteins that controls the activity of caspase-1, pro-IL-1b and pro-IL-18. It acts in inflammatory processes and in pyropoptosis. The lower intestine is densely populated by a community of commensal bacteria that, under healthy conditions, are beneficial to the host. Some evidence suggests that the gut microbiota influences regulation of the inflammasome. Components of inflammasomes have been shown to have a protective function against development of experimental colitis, dependent on IL-18 production. However the precise mechanisms and the role of the inflammasome in maintaining a healthy host-microbial mutualism remains unknown. To address this question, we have performed axenic (GF) and gnotobiotic in vivo experiments to investigate how the inflammasome components mainly at the level of intestinal epithelial cells (IECs) are regulated under different hygiene conditions. We have established that gene expression of the inflammasome components NLRC4, NLRP3, NLRP6, NLRP12, caspase-1, ASC and IL-18 do not differ between germ-free and colonised conditions under steady-state. In contrast, induction in IL-18 was observed following infection with the pathobiont Segmented Filamentous Bacteria or the pathogen C. rodentium. Additional preliminar findings suggest that a more diverse intestinal flora, like specific pathogen-free (SPF) flora, is more efficient in inducing basal activation of the inflammasome and especially production of IL-18 by IECs, shortly after colonisation. We are also in the process of testing if basal activation of the inflammasome upon intestinal colonization with commensal bacteria helps to protect the host from potential pathobiont bacteria, like C. rodentium, SFB, Prevotella and TM7.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

Recent technological advances have resulted in the production of safe subunit and synthetic small peptide vaccines. Unfortunately, these vaccines are weakly or non-immunogenic in the absence of an immunological adjuvant (agents that can induce strong immunity to antigens). In addition, in order to prevent and/or control infection at the mucosal surface, stimulation of the mucosal immune system is essential. This may be achieved via the common mucosal immune system by exposure to antigen at a mucosal surface remote from the area of infection. Initial studies investigated the potential of multiple emulsions in effecting oral absorption and the subsequent immune responses to a lipopolysaccharide vaccine (LPS) after immunisation. Nasal delivery of LPS was carried out in parallel work using either aqueous solution or gel formulations. Tetanus toxoid vaccine in simple solution was delivered to guinea pigs as free antigen or entrapped in DSPC liposomes. In addition, adsorbed tetanus toxoid vaccine was delivered nasally free or in an aerosil gel formulation. This work was extended to investigate guinea pigs immunised by various mucosal routes with a herpes simplex virus subunit vaccine prepared from virus infected cells and delivered in gels, multiple emulsions and liposomes. Comparable serum antibody responses resulted but failed to produce enhanced protection against vaginal challenge when compared to subcutaneous immunisation with alhydrogel adjuvanted vaccine. Thus, immunisation of the mucosal surface by these methods may have been inadequate. These studies were extended in an attempt to protect against HSV genital challenge by construction of an attenuated Salmonella typhimurium HWSH aroA mutant expressing a cloned glycoprotein D-l gene fused to the Es-cherichia coli lac z promoter. Preliminary work on the colonisation of guinea pigs with S. typhimurium HWSH aroA mutants were carried out, with the aim of using the guinea pig HSV vaginal model to investigate protection.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Revascularization outcome depends on microbial elimination because apical repair will not happen in the presence of infected tissues. This study evaluated the microbial composition of traumatized immature teeth and assessed their reduction during different stages of the revascularization procedures performed with 2 intracanal medicaments. Fifteen patients (7-17 years old) with immature teeth were submitted to the revascularization procedures; they were divided into 2 groups according to the intracanal medicament used: TAP group (n = 7), medicated with a triple antibiotic paste, and CHP group (n = 8), dressed with calcium hydroxide + 2% chlorhexidine gel. Samples were taken before any treatment (S1), after irrigation with 6% NaOCl (S2), after irrigation with 2% chlorhexidine (S3), after intracanal dressing (S4), and after 17% EDTA irrigation (S5). Cultivable bacteria recovered from the 5 stages were counted and identified by means of polymerase chain reaction assay (16S rRNA). Both groups had colony-forming unit counts significantly reduced after S2 (P < .05); however, no significant difference was found between the irrigants (S2 and S3, P = .99). No difference in bacteria counts was found between the intracanal medicaments used (P = .95). The most prevalent bacteria detected were Actinomyces naeslundii (66.67%), followed by Porphyromonas endodontalis, Parvimonas micra, and Fusobacterium nucleatum, which were detected in 33.34% of the root canals. An average of 2.13 species per canal was found, and no statistical correlation was observed between bacterial species and clinical/radiographic features. The microbial profile of infected immature teeth is similar to that of primarily infected permanent teeth. The greatest bacterial reduction was promoted by the irrigation solutions. The revascularization protocols that used the tested intracanal medicaments were efficient in reducing viable bacteria in necrotic immature teeth.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

In this work the archaea and eubacteria community of a hypersaline produced water from the Campos Basin that had been transported and discharged to an onshore storage facility was evaluated by 16S recombinant RNA (rRNA) gene sequence analysis. The produced water had a hypersaline salt content of 10 (w/v), had a carbon oxygen demand (COD) of 4,300 mg/l and contains phenol and other aromatic compounds. The high salt and COD content and the presence of toxic phenolic compounds present a problem for conventional discharge to open seawater. In previous studies, we demonstrated that the COD and phenolic content could be largely removed under aerobic conditions, without dilution, by either addition of phenol degrading Haloarchaea or the addition of nutrients alone. In this study our goal was to characterize the microbial community to gain further insight into the persistence of reservoir community members in the produced water and the potential for bioremediation of COD and toxic contaminants. Members of the archaea community were consistent with previously identified communities from mesothermic reservoirs. All identified archaea were located within the phylum Euryarchaeota, with 98 % being identified as methanogens while 2 % could not be affiliated with any known genus. Of the identified archaea, 37 % were identified as members of the strictly carbon-dioxide-reducing genus Methanoplanus and 59 % as members of the acetoclastic genus Methanosaeta. No Haloarchaea were detected, consistent with the need to add these organisms for COD and aromatic removal. Marinobacter and Halomonas dominated the eubacterial community. The presence of these genera is consistent with the ability to stimulate COD and aromatic removal with nutrient addition. In addition, anaerobic members of the phyla Thermotogae, Firmicutes, and unclassified eubacteria were identified and may represent reservoir organisms associated with the conversion hydrocarbons to methane.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Rhodotorula glutinis CCT 2182, Rhodosporidium toruloides CCT 0783, Rhodotorula minuta CCT 1751 and Lipomyces starkeyi DSM 70296 were evaluated for the conversion of sugars from Brazilian molasses into single-cell oil (SCO) feedstock for biodiesel. Pulsed fed-batch fermentations were performed in 1.65 l working volume bioreactors. The maximum specific growth rate (µmax), lipid productivity (Pr) and cellular lipid content were, respectively, 0.23 h(-1), 0.41 g l(-1) h(-1), and 41% for Rsp. toruloides; 0.20 h(-1), 0.27 g l(-1) h(-1), and 36% for Rta. glutinis; 0.115 h(-1), 0.135 g l(-1) h(-1), and 27 % for Rta. minuta; and 0.11 h(-1), 0.13 g l(-1) h(-1), and 32% for L. starkeyi. Based on their microbial lipid productivity, content, and profile, Rsp. toruloides and Rta. glutinis are promising candidates for biodiesel production from Brazilian molasses. All the oils from the yeasts were similar to the composition of plant oils (rapeseed and soybean) and could be used as raw material for biofuels, as well as in food and nutraceutical products.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

By comparing the SEED and Pfam functional profiles of metagenomes of two Brazilian coral species with 29 datasets that are publicly available, we were able to identify some functions, such as protein secretion systems, that are overrepresented in the metagenomes of corals and may play a role in the establishment and maintenance of bacteria-coral associations. However, only a small percentage of the reads of these metagenomes could be annotated by these reference databases, which may lead to a strong bias in the comparative studies. For this reason, we have searched for identical sequences (99% of nucleotide identity) among these metagenomes in order to perform a reference-independent comparative analysis, and we were able to identify groups of microbial communities that may be under similar selective pressures. The identification of sequences shared among the metagenomes was found to be even better for the identification of groups of communities with similar niche requirements than the traditional analysis of functional profiles. This approach is not only helpful for the investigation of similarities between microbial communities with high proportion of unknown reads, but also enables an indirect overview of gene exchange between communities.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.