145 resultados para Metarhizium-anisopliae
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Antimicrobial photodynamic treatment (PDT) is a promising method that can be used to control localized mycoses or kill fungi in the environment. A major objective of the current study was to compare the conidial photosensitization of two fungal species (Metarhizium anisopliae and Aspergillus nidulans) with methylene blue (MB) and toluidine blue (TBO) under different incubation and light conditions. Parameters examined were media, photosensitizer (PS) concentration and light source. PDT with MB and TBO resulted in an incomplete inactivation of the conidia of both fungal species. Conidial inactivation reached up to 99.7%, but none of the treatments was sufficient to achieve a 100% fungicidal effect using either MB or TBO. PDT delayed the germination of the surviving conidia. Washing the conidia to remove unbound PS before light exposure drastically reduced the photosensitization of A. nidulans. The reduction was much smaller in M. anisopliae conidia, indicating that the conidia of the two species interact differently with MB and TBO. Conidia of green and yellow M. anisopliae mutants were less affected by PDT than mutants with white and violet conidia. In contrast to what occurred in PBS, photosensitization of M. anisopliae and A. nidulans conidia was not observed when PDT was performed in potato dextrose media.
Resumo:
Foi avaliada a infecção de larvas de Conotrachelus humeropictus Fiedler, séria praga do cacaueiro (Theobroma cacao L.) e do cupuaçuzeiro (T. grandiflorum (Willd. ex Spreng.) Schum.) na Amazônia brasileira, por Metarhizium anisopliae (Metsch.) Sor. e Beauveria bassiana (Bals.) Vuill. A pesquisa foi desenvolvida nos campos experimentais da Comissão Executiva do Plano da Lavoura Cacaueira - CEPLAC, em Ouro Preto D'Oeste, Rondônia. Foram testadas suspensões de 3,93 χ 1010 conídios/ml de M. anisopliae e 4,26 χ 1010 conídios/ml de B. bassiana, pulverizadas superficialmente em solo contido em recipientes de PVC, onde em diferentes dias após a pulverização (um, três, sete e quatorze dias) liberou-se larvas do último ínstar da praga. Beauveria bassiana mostrou-se mais eficiente (52,0% de mortalidade) do que M. anisopliae (42,7%), evidenciando assim, seu maior potencial no controle da praga. Os índices de mortalidade foram estatisticamente iguais para larvas liberadas até o 7º dia da contaminação, decrescendo significativamente no 14º dia. A queda na efetividade pode estar associada à presença de microrganismos antagonistas no solo.
Resumo:
Foi estudada a produção de conídios em meio completo e em meio contendo diferentes concentrações de farinha de arroz, no fungo entomopatogênico Metarhizium anisopliae. As linhagens mais produtivas em meio completo foram M, E6, A4 e E9; em meio de arroz, verificou-se que maior produção ocorria quando o arroz era adicionado na concentração de 60 g/l.
Resumo:
Twenty three isolates of Beauveria bassiana and 13 isolates of Metarhizium anisopliae were tested on third instar nymphs of Triatoma infestans, a serious vector of Chagas disease. Pathogenicity tests at saturated humidity showed that this insect is very susceptible to fungal infection. At lower relative humidity (50%), conditions expected in the vector microhabitat, virulence was significantly different among isolates. Cumulative mortality 15 days after treatment varied from 17.5 to 97.5%, and estimates of 50% survival time varied from 6 to 11 days. Maintaining lower relative humidity, four B. bassiana and two M. anisopliae isolates were selected for analysis of virulence at different conidial concentrations and temperatures. Lethal concentrations sufficient to kill 50% of insects (LC50) varied from 7.1x105 to 4.3x106 conidia/ml, for a B. bassiana isolate (CG 14) and a M. anisopliae isolate (CG 491) respectively. Most isolates, particularly B. bassiana isolates CG 24 and CG 306, proved to be more virulent at 25 and 30°C, compared to 15 and 20°C. The differential virulence at 50% humidity observed among some B. bassiana isolates was not correlated to phenetic groups in cluster analysis of RAPD markers. In fact, the B. bassiana isolates analyzed presented a high homogeneity (> 73% similarity).
Resumo:
The effect of relative humidity (43%, 75%, 86% and > 98%) on Aedes aegypti eggs treated with Metarhizium anisopliae or water only was tested for up to a six months exposure at 25ºC. Survival of larvae inside eggs was clearly affected by the lowest humidity (43%) tested, and eclosion diminished at all humidities after increasing periods of exposure. M. anisopliae showed to have a strong ovicidal activity only at humidity close to saturation. No difference of activity was found between conidia and hyphal bodies tested. This fungus affected larvae inside eggs and has potential as a control agent of this important vector in breeding sites with high moisture.
Resumo:
Avaliou-se a patogenicidade de isolados dos fungos Metarhizium anisopliae (Metsch.) Sorokin e Beauveria bassiana (Bals.) Vuillemin a Scaptocoris carvalhoi Becker, 1967 sob condições de laboratório e em casa de vegetação. Os experimentos foram conduzidos na Embrapa Agropecuária Oeste de Dourados, MS, durante o ano de 2003. Foram avaliados dez isolados de M. anisopliae e onze de B. bassiana, em laboratório, utilizando-se o delineamento inteiramente casualizado, com cinco repetições (10 adultos e 5 ninfas/parcela). A patogenicidade de M. anisopliae (Ma69) também foi testada em ninfas e adultos, separadamente, em laboratório e casa de vegetação. Os níveis de mortalidade do percevejo foram maiores com os isolados de M. anisopliae que variaram de 73,3% a 94,7% contra 10,7% a 78,7% para os de B. bassiana. Em casa de vegetação, a porcentagem de mortalidade do percevejo causada pelo fungo Ma69 foi de 57,3% e não foi constatada diferença por este isolado quanto à mortalidade de ninfas e adultos, em laboratório. Todavia, em casa de vegetação, os níveis de mortalidade foram significativamente maiores (p<0,05) para ninfas (38,4%) do que para os adultos (16,2%). Com base nos resultados obtidos, concluiu-se que o isolado Ma69 de M. anisopliae foi mais eficiente para S. carvalhoi tanto em laboratório quanto em casa de vegetação, constituindo em uma alternativa promissora para ser utilizado como inseticida microbiano em condições de campo.
Resumo:
The fungus Metarhizium anisopliae var. acridum, strain CG 423, was tested under field conditions against the gregarious grasshopper Rhammatocerus schistocercoides (Rehn) (Orthoptera: Acrididae). Conidia formulated in a racemic mixture of soybean oil and kerosene were sprayed under field conditions using an ultralow-volume hand-held atomizer Ulva Plus adjusted to deliver 2.9 L/ha. Bands composed of 2nd instar nymphs were treated with either 5.0x10(12) or 1.0x10(13) viable conidia/ha. The number of insects in each band was estimated at day one following spraying and by the end of the field trial (15 to 16 days post-treatment). Reductions in population size reached, in average, 65.8% and 80.4% for bands treated with the higher and lower dosage, respectively. For both dosages, total mortality rates of insects collected at two days post-application, and kept in cages for 14 days under lab conditions, showed no significant differences as compared to that obtained with insects collected immediately after spraying. Healthy insects were fed to native grasses sprayed on the field with 1.0x10(13) viable conidia/ha. Mortality levels of the nymphs fed on grasses collected two and four days post-application were not affected when compared to nymphs fed on grasses collected immediately following application.
Resumo:
The objective of this study was to characterize the Peruvian isolate of Metarhizium anisopliae var. acridum, CG 863, obtained from the grasshopper Schistocerca interrita, a crop pest in Peru. The characterization was done by comparing this isolate with two other ones of M. anisopliae var. acridum, from Brazil and Australia, and with an isolate of M. anisopliae var. anisopliae. The three M. anisopliae var. acridum isolates had similar growth profiles in agar plates at 25°C and 37°C, and similar RAPD patterns according to the analysis of three primers. However, regarding these parameters and conidial size, these isolates were very distinct when compared to M. anisopliae var. anisopliae isolate. Bioassays indicated that the Peruvian isolate is as pathogenic as the Brazilian isolate against nymphs of Rhammatocerus schistocercoides.
Resumo:
O objetivo deste trabalho foi avaliar a eficiência do controle exercido por Metarhizium anisopliae na população de Boophilus microplus, em pastagens de Brachiaria brizantha, e do híbrido Tifton 85 (Cynodon spp.), artificialmente infestadas com fêmeas ingurgitadas do carrapato. Trinta canteiros com 1 m² de área cada foram distribuídos aleatoriamente. Quinze foram pulverizados com esporos do fungo e quinze controles em cada forrageira, constituindo cinco repetições de cada tratamento, foram infestados com número e peso padronizados de fêmeas ingurgitadas do ácaro. Aplicou-se o fungo, na concentração de 1,8x10(8) conídios mL-1, em três situações: pulverização antes da infestação com o carrapato, após a infestação e posterioriormente à emergência das primeiras larvas nos capins. A ação do fungo foi avaliada no 35º, 38º, 41º, 48º, 55º e 61º dia pós-infestação, por meio da contagem de larvas recuperadas. Obteve-se controle de larvas do ácaro, que, nas avaliações realizadas entre o 35º e o 48º dia pós-infestação, variou entre 87% e 94%. As médias das contagens de estágios larvares do carrapato foram menores em todas as amostragens realizadas no capim-Tifton 85, indicando que houve efeito da pastagem na ação do fungo. A situação de aplicação influencia a atividade do fungo, com melhor resultado nas coletas realizadas entre o 41º e 55º dia após infestação em B. brizantha, e aplicação dos conídios logo após a emergência das primeiras larvas.
Resumo:
Thrips are reported as important pests on table grapes in United States and several countries of Europe. Damage caused by thrips, particulary Frankliniella occidentalis, was observed on niagara table grape crop in Limeira-SP, Brazil. During the blooming period, high thrips densities were observed feeding on pollen and small berries. The symptoms left were more visible after the development of the berries and were characterized by dark scars and suberized surface on berries, sometimes causing the berry to crack, and the seed to prolapse. The effect of insecticides thiacloprid or methiocarb, associated or not with the entomopathogenic fungus Metarhizium anisopliae were evaluated during the blooming period. For evaluation of thrips damage on fruits, the treatments were applied three additional times, 7, 14 and 21 days after the first application. The treatments were: a) M. anisopliae (strain 1037) 1x10(7) conidia/mL; b) thiacloprid 20mL/100L; c-d) methiocarb 100 and 150mL/100L; e) methiocarb 100mL/100L + M. anisopliae 1x10(7) conidia/mL. Only methiocarb, associated or not with the fungus, was effective in reducing thrips infestation, and no phytotoxic damage was observed. The efficiency of methiocarb 150mL/100L and the insecticide associated with the fungus for the control of the thrips population was 84.2 and 95.5%, respectively. In both cases, there was a reduction of approximately 70% in the number of berries with scars symptoms. For control of thrips on table grapes, chemical insecticides associated or not with M. anisopliae should be applied during the blooming period of the crop.
Resumo:
Conidia of the insect pathogenic fungus, Metarhizium anisopliae play an important role in pathogenicity because they are the infective propagules that adhere to the surface of the insect, then germinate and give rise to hyphal penetration of the insect cuticle. Conidia are produced in the final stages of insect infection as the mycelia emerge from the insect cadaver. The genes associated with conidiation have not yet been studied in this fiingus. hi this study we used the PCR-based technique, suppression subtractive hybridization (SSH) to selectively amplify conidial-associated genes in M. anisopliae. We then identified the presence of these differentially expressed genes using the National Center for Biotechnology Information database. One of the transcripts encoded an extracellular subtilisin-like protease, Prl, which plays a fundamental role in cuticular protein degradation. Analysis of the patterns of gene expression of the transcripts using RT-PCR indicated that conidial-associated cDNAs are expressed during the development of the mature conidium. RT-PCR analysis was also performed to examine in vivo expression of Prl during infection of waxworm larvae {Galleria mellonelld). Results showed expression of Prl as mycelia emerge and produce conidia on the surface of the cadaver. It is well documented that Prl is produced during the initial stages of transcuticular penetration by M. anisopliae. We suggest that upregulation of Prl is part of the mechanism by which reverse (from inside to the outside of the host) transcuticular penetration of the insect cuticle allows subsequent conidiation on the cadaver.
Resumo:
Strain improvement of the insect pathogenic fungus Metarhizium anisopUae is necessary to increase its virulence towards agricultural pests and thus improve its commercial efficacy. Nevertheless, the release of genetically modified conidia in crop fields may negatively affect the ecosystem. Controlling conidiation is a potential means of limiting the release of engineered strains since conidia are the infective propagules and the means of dispersal. The purpose of this study was to research the colony development of M. anisopUae to identify potential targets for genetic manipulation to control conidiation. Following Agrobacterium tumefaciem insertional mutagenesis, phenotypic mutants were characterized using Y-shaped adaptor dependent extension PCR. Four of 1 8 colony development recombinants had T-DNA flanking sequences with high homology to genes encoding known signaling pathway proteins that regulate pathogenesis and/or asexual development in filamentous fungi. Conidial density counts and insect bioassays suggested that a Serine/Threonine protein kinase COTl homolog is not essential for conidiation or virulence. Furthermore, a choline kinase homolog is important for conidiation, but not virulence. Finally, the regulator of G protein signaling CAG8 and a NADPH oxidase NoxA homolog are necessary for conidiation and virulence. These genes are candidates for further investigation into the regulatory pathways controlling conidiation to yield insight into promising gene targets for biocontrol strain improvement.
Resumo:
A resistência a doenças em plantas transgênicas tem sido obtida por meio da expressão de genes isolados de bactérias, fungos micoparasitas e plantas. Neste trabalho, relatamos a utilização de um gene do fungo entomopatogênico Metarhizium anisopliae como modo de gerar resistência a doenças fúngicas em plantas. O gene chit1 codifica a quitinase CHIT42 (EC 3.2.1.14), pertencente a uma classe de glicosil-hidrolases capazes de converter quitina em oligômeros de N-acetil-glicosamina (NAcGlc). Quando presentes em tecidos vegetais, supõese que as quitinases ataquem especificamente a parede celular de fungos invasores, provocando danos às hifas e causando a morte por lise das células fúngicas. Deste modo, dois diferentes grupos de plantas transgênicas de Nicotiana tabacum foram produzidos: no primeiro deles, denominado chitplus, os indivíduos possuem o gene chit1 sob o controle do promotor CaMV 35S. O segundo grupo, demoninado chitless, consiste de plantas transformadas com um T-DNA não contendo o gene do fungo. Trinta e quatro plantas transgênicas resistentes à canamicina (17 de cada grupo) foram regeneradas a partir de discos de folhas infectados por Agrobacterium tumefaciens. A produção da quitinase em extratos protéicos de folhas foi analisada por zimogramas em SDS-PAGE contendo glicol-quitina e corados por calcoflúor branco, na forma de um screening dos transgênicos primários. As plantas transgênicas foram testadas, ainda, por meio de ensaios colorimétricos empregando oligômeros sintéticos de NAcGlc como substratos específicos, além de immunoblot e Western blot com soro anti-quitinase. A quantidade de enzima recombinante nas plantas chitplus variou desde nenhuma atividade detectável a elevados níveis de expressão da enzima. A hibridização de Southern blot demonstrou que o número de cópias do gene chit1 integradas no genoma vegetal foi estimado entre uma e quatro. A primeira geração de plantas transgênicas geradas por autofecundação de parentais portadores de duas cópias do transgene foi testada com relação à estabilidade da herança do transgene e em 43 de um total de 67 descendentes, originados de quatro cruzamentos independentes, o padrão de segregação não diferiu das proporções Mendelianas esperadas. Ensaios de resistência, desafiando as plantas transgênicas com o basidiomiceto Rhizoctonia solani foram realizados e uma evidente diminuição da área foliar contendo lesões fúngicas foi observada entre as linhagens transgênicas, embora variações na atividade quitinolítica tenham influenciado o nível de resistência. Nossos resultados sugerem uma relação direta entre a atividade específica de quitinase e ao aumento nos níveis de resistência às lesões causadas pela infecção por R. solani.
Resumo:
A caracterização molecular e morfofisiológica de 28 isolados de Metarhizium ssp. foi avaliada por análises de seqüências do espaçador transcrito interno (ITS1 e ITS2), presença de elementos dsRNA e taxa de crescimento e esporulação em diferentes temperaturas e pH. A patogenicidade de 19 isolados do fungo entomopatogênico Metarhizium ssp. foi avaliada para fêmeas ingurgitadas do carrapato Boophilus microplus. As alterações cronológicas durante o processo de infecção Metarhizium anisopliae isolado E6 em B. microplus foi avaliada em detalhe por microscopia óptica e eletrônica de varredura e transmissão. O seqüenciamento do espaçador transcrito interno confirmou a identidade taxonômica dos isolados avaliados como M. anisopliae var. anisopliae ou M. anisopliae var. majus e mostrou que dois isolados (CG291 e CG423), previamente classificados como Metarhizium flavoviride, são pertencentes a M. anisopliae var. anisopliae. Os testes sobre a influência da temperatura e pH no desenvolvimento e esporulação dos isolados evidenciaram que a melhor temperatura de crescimento para a maioria desses foi 28oC e que o crescimento foi ótimo na faixa de pH entre 4 a 9. Os bioensaios mostraram que três isolados (C14, CG47 e CG97) foram altamente patogênicos para fêmeas ingurgitadas de B. microplus sendo tão virulentos quanto o isolado E6, previamente analisado, causando cerca de 90-100% de mortalidade ao 4o dia de infecção. Outros isolados foram menos virulentos ou não mostraram virulência para o carrapato. A presença de dsRNA foi avaliada em 28 isolados e detectada em 21 isolados. Vários padrões de dsRNA foram observados baseados no tamanho molecular analisado por eletroforese em gel de agarose. Nenhuma correlação foi observada entre a presença de dsRNA e a virulência do fungo. As observações microscópicas evidenciaram que o fungo M. anisopliae isolado E6 invade seu hospedeiro por penetração direta da cutícula, sendo que este processo envolveu as etapas de adesão e germinação dos conídios, formação do apressório e penetração do fungo na cutícula do hospedeiro. A adesão e germinação dos conídios na superfície da cutícula se iniciou após 24 h de infecção. Neste mesmo tempo, ocorreu diferenciação do apressório, estrutura que exerce a pressão mecânica durante o processo de penetração, sendo que este processo é facilitado pela ação de enzimas hidrolíticas secretadas pelo fungo. A penetração de algumas hifas ocorreu até 24 h após a infecção do fungo, embora, neste mesmo tempo de infecção, a maioria dos conídios ainda estivesse em processo de germinação. A penetração em massa do fungo foi observada 72 h após a infecção e, após 96 h, as hifas emergiram na superfície da cutícula para originarem novos conídios e assegurarem a perpetuação do fungo. A intensa invasão das hifas nos tecidos adjacentes confirmou a eficácia do isolado E6 na infecção do carrapato B. microplus.