Little cicada of sugarcane Mahanarva posticata (Homoptera: Cercopidae). A Brazilian agricultural pest. Morpho-histological study of salivary glands

Little cicadas are homopteran insect pests of sugarcane plantations. As these insects suck out the sap from the leaf parenchyma, they inoculate a toxic saliva that damages the plant vessels, thus promoting the loss of glucose by the affected plant. The morphological and histological analyses of the salivary glands of the little cicada Mahanarva posticata, revealed that these glands are formed by 2 portions: one portion comprises a group of acini and has been denominated as the principal gland; the second portion is filamentous in nature and has been denominated as the accessory gland; it is formed by very long and fine filaments. The acinous portion of the gland can be subdivided into 2 lobes: an anterior lobe formed by 3 lobules (I, II, III), and a posterior lobe formed by lobule IV and the excretory duct. Histologically, the salivary glands showed that the filaments are empty sutructures composed by several internal channels with secretion granules being observed in the cytoplasm of the cells of the secretory filaments. Lobules I and II of the principal gland are characterized by being highly basophilic and for accumulating a large amount of secretion in both the cytoplasm of the cells and inside secretion vesicles. Histochemically, we verified that the secretion produced by these glands is lipidic and protein in nature, with the production of polysaccharides being very low. The differences in stain and appearance of the different regions of the salivary gland lead us to believe that the final glandular product is lipoproteic in nature.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Composições contendo o isolado jab 68 do fungo entomopatogênico metarhizium anisopliae e uso das composições

Essa invenção se refere ao desenvolvimento de composições com o isolado jab 68 do fungo entomopatogânico metarhizium anisopliae, em peletes de alginato de sádio, e em óleo emulsionável e pó molhável. As composições propostas são usadas no controle da mosca-dos-chifres. As composições em óleo emulsionável e pó molhável também podem ser usadas para o controle do carrapato de bovinos rhipicephalus (boophilus) microplus ou do carrapato de cães rhipicephalus sanguineus e para controle da cigarrinha da folha (mahanarva posticata) e da raiz (mahanarva fimbriolata) da cana-de-açúcar e das pastagens (deois flavopicta).

Chromosome analysis of two species of sugar cane pests of the genus Mahanarva (Homoptera, Cercopidae)

Studies on the cytogenetics of Homoptera are scarce. Some references in the literature have reported a chromosome number for the genus ranging from n=5 to 19 and 2n=10 to 2n=39 chromosomes. The genus Mahanarva includes two species of agricultural importance as pests of sugar cane culture in Brazil. We report here the first data concerning the chromosome number and morphology of the species Mahanarva fimbriolata and M. posticata. The chromosome number observed for the two species was 2n=19 for males and 2n=20 for females. The sex determining mechanism of these species was of the XX/X0 type (for males and females, respectively), with chromosome X being the smallest in the complement.

Effect of sugarcane varieties on the development of Mahanarva fimbriolata (Hemiptera: Cercopidae)

The sugarcane spittlebug, Mahanarva fimbriolata (Hemiptera: Cercopidae), is considered the most important pest of sugarcane harvested without the burning of trash, or green cane, in Brazil. The objective of this work was to compare the biology of M. fimbriolata on six sugarcane varieties: SP79-1011, SP80-1816, SP80-1842, SP81-3250, RB72454, and RB835486. The experiments were conducted at a temperature of 25 +/- 1 degrees C, RH of 70 +/- 10%, and a photoperiod of 14:10 [L:D]. Variety RB72454 outperformed the rest, reducing the nymphal population that fed on its roots by 50%. With regard to adults, variety SP81-3250 allowed greater mean longevity of males (38 days) and females (51 days), greater mean oviposition period (46 days), and higher mean fecundity (1215 eggs/female); these parameters were statistically different from those obtained with other varieties. For the eggs, there was no significant effect of variety on developmental time or viability. Consequently, the variety SP81-3250 should be avoided in areas predisposed to the occurrence of M. fimbriolata.

Descrição de três novas espécies de Mahanarva (Hemiptera, Cercopidae, Ischnorhininae)

Três novas espécies de cigarrinhas neotropicais do gênero Mahanarva são descritas: M. (M.) rubrovenata, M. (M.) webbi e M. (M.) dabliosignata, todas do Brasil.

Sugarcane response to two biotic stressors: Diatraea saccharalis and Mahanarva fimbriolata

In a field experiment in 2007/08 in São Paulo state, Brazil cane was exposed to sugarcane borer (Diatraea saccharalis) and spittlebug (Mahanarva fimbriolata) alone or in combination. Plots comprised 2 m(2) caged and uncaged sugarcane stalks. Compared with the caged (un-infested) control, spittlebug nymphs decreased cane yield by 17.6%, whereas infestation from spittlebug nymphs + sugarcane borer combined and sugarcane borer alone, decreased cane yields by 15.5% and 6.9%, respectively. There was no significant difference among the treatments in levels of soluble solids and cane sucrose content.

Influence of Mahanarva fimbriolata (Stål) (Hemiptera: Cercopidae) injury on the quality of cane juice

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Ultrastructural study of the salivary glands of the sugarcane spittlebug Mahanarva fimbriolata (Stal, 1854) (Euhemiptera : Cercopidae)

Spittlebugs are insects that suck sap from plants and regurgitate saliva containing toxic enzymes into the leaves. As a consequence, the conductive channels are blocked resulting in dry leaves, thus giving a burned aspect to the plantation. This work performed ultrastructural analyses of the salivary glands of the sugarcane spittlebug Mahanarva fimbriolata, since these organs produce the enzymes that are injected into the plants, thus being responsible for the economic losses in the production of sugarcane. Three kinds of secretory cells are found in principal gland, forming the lobules I-IV. The main differences among these cells relate to size, morphology and electron density of the secretory vesicles. The accessory glands contain different secretory vesicles to those in the principal gland. Muscular cells are found around the entire gland. The different secretory vesicles found in both principal and accessory glands indicate that the gland produces different substances or that the secretion in the interior of cells passes through a maturation process. (c) 2005 Elsevier Ltd. All rights reserved.

Ultrastructural study of the ovary of the sugarcane spittlebug Mahanarva fimbriolata (Hemiptera)

The present study describes the ultrastructure of meroistic telotrophic ovaries of the sugarcane spittlebug Mahanarva fimbriolata. In this type of ovary, nurse cells, oogonia, and prefollicular tissue are located at the terminal (distal) regions or tropharium of ovarioles. Oocytes in different developmental stages, classified from I to V, are observed in the vitellarium. Stage I oocytes do not exhibit intercellular spaces in the follicular epithelium, suggesting that synthesis and production of yolk during this stage occurs only through endogenous processes. Small yolk granules of different electron densities are present in the cytoplasm. Few lipid droplets are observed. Stage 11 oocytes exhibit small intercellular spaces in the follicular epithelium. More protein as well as lipid yolk granules are observed in the cytoplasm. In stage III oocytes, intercellular spaces in the follicular epithelium are larger than those observed in the previous stage. Electrondense protein granules of various sizes, larger than those observed in stage 11 oocytes predominate in the cytoplasm. Smaller lipid droplets are also present. In stage IV oocytes, the follicular epithelium exhibits large intercellular spaces. Our data clearly indicate that the opening of these spaces in the follicular epithelium of M. fimbriolata oocytes increases as the intake of exogenous proteins intensifies, that is, in stages IV and Voocytes. During these stages, granular yolk becomes viscous due to the lysis of granules. In stage Voocytes, viscous yolk predominates in the cytoplasm. This type of yolk, however, has not been described for other orders of insects. The chorion of M. fimbriolata oocytes consists of an external layer (exochorion) and an internal one (endochorion), which is in direct contact with the oocyte. Numerous small pores that probably facilitate oxygenation of the internal structures inside the eggs are observed in the exochorion. (c) 2006 Elsevier Ltd. All rights reserved.

Female reproductive system of the sugarcane spittlebug Mahanarva fimbriolata (Auchenorrhyncha): Vitellogenesis dynamics and protein quantification

The present study aimed describing the ovaries of the sugarcane spittlebug Mahanarva fimbriolata which are meroistic telotrophic with nurse cells and oocytes located in the tropharium. SEM revealed paired ovaries located dorsolaterally around the intestine, and oocytes exhibiting shapes ranging from round (less developed) to elliptic (more developed), suggesting a simultaneous, although, asynchronous development. Based on histological data we classified the oocytes in stages from I to V. Stage I oocytes exhibit follicular epithelium with cubic and/or prismatic cells, fine cytoplasmic granules. Stage II oocytes present intercellular spaces in the follicular epithelium due to the incorporation of yolk elements from the hemolymph. Small granules are present in the periphery of oocytes while larger granules are observed in the center. Stage III oocytes are larger and intercellular spaces in the follicular epithelium are evident, as well as the interface between follicular epithelium and oocyte. Yolk granules of different sizes are present in the cytoplasm. During this stage, chorion deposition initiates. Stage IV oocytes exhibit squamous follicular cells and larger intercellular spaces when compared to those observed in the previous stage. The oocyte cytoplasm present granular and viscous yolk, the latter is the result of the breakdown of granules. Stage V oocytes exhibit a follicular epithelium almost completely degenerated, smaller quantities of granular yolk and large amounts of viscous yolk. Based on our findings we established the sequence of yolk deposition in M. fimbriolata oocyte as follows: proteins and lipids, which are first produced by endogenous processes in stages I and II oocytes. Exogenous incorporation begins in stage III. In stages I and II oocytes, lipids are also produced by follicular epithelial cells. The third element to be deposited is polysaccharides, mainly found as complexes. Therefore, the yolk present in the oocytes of this species consists of glycolipoproteins. Molecular weights of proteins present in M. fimbriolata oocytes ranged from 10 to 92 KDa, differently from vitellogenin, the most common protein present in insect oocytes, weighing approximately 180 KDa. (c) 2006 Elsevier Ltd. All rights reserved.

Meiotic chromosomes and nucleolar behavior in testicular cells of the grassland spittlebugs Deois flavopicta, Mahanarva fimbriolata and Notozulia entreriana (Hemiptera, Auchenorrhyncha)

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Influência dos estressores bióticos Diatraea saccharalis (Fabr.) (Lepidoptera: Crambidae) e Mahanarva fimbriolata (Stål) (Hemiptera: Cercopidae) na produtividade e qualidade tecnológica da cana-de-açúcar

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Identificação em cana-de-açúcar de genes de resistência a Mahanarva fimbriolata (Stål, 1854) (Hemiptera: Cercopidae)

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Danos causados por Mahanarva fimbriolata (STAL, 1854) na qualidade da cana e processo fermentativo

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)