Improving 3D Keypoint Detection from Noisy Data Using Growing Neural Gas

3D sensors provides valuable information for mobile robotic tasks like scene classification or object recognition, but these sensors often produce noisy data that makes impossible applying classical keypoint detection and feature extraction techniques. Therefore, noise removal and downsampling have become essential steps in 3D data processing. In this work, we propose the use of a 3D filtering and down-sampling technique based on a Growing Neural Gas (GNG) network. GNG method is able to deal with outliers presents in the input data. These features allows to represent 3D spaces, obtaining an induced Delaunay Triangulation of the input space. Experiments show how the state-of-the-art keypoint detectors improve their performance using GNG output representation as input data. Descriptors extracted on improved keypoints perform better matching in robotics applications as 3D scene registration.

Estrutura a partir do Movimento em Sistemas Autónomos

Mestrado em Engenharia Electrotécnica e de Computadores - Ramo de Sistemas Autónomos

Estudio sobre la extracción de puntos característicos en imágenes y sus aplicaciones

En aquest treball realitzem un estudi sobre la detecció y la descripció de punts característics, una tecnologia que permet extreure informació continguda en les imatges. Primerament presentem l'estat de l'art juntament amb una avaluació dels mètodes més rellevants. A continuació proposem els nous mètodes que hem creat de detecció i descripció, juntament amb l'algorisme òptim anomenat DART, el qual supera l'estat de l'art. Finalment mostrem algunes aplicacions on s'utilitzen els punts DART. Basant-se en l'aproximació de l'espai d'escales Gaussià, el detector proposat pot extreure punts de distint tamany invariants davant canvis en el punt de vista, la rotació i la iluminació. La reutilització de l'espai d'escales durant el procés de descripció, així com l'ús d'estructures simplificades i optimitzades, permeten realitzar tot el procediment en un temps computacional menor a l'obtingut fins al moment. Així s'aconsegueixen punts invariants i distingibles de forma ràpida, el qual permet la seva utilització en aplicacions com el seguiment d'objectes, la reconstrucció d'escenaris 3D i en motors de cerca visual.

Individuazione di punti salienti in dati 3D mediante rappresentazioni strutturate

Questa tesi si inserisce nel filone di ricerca dell'elaborazione di dati 3D, e in particolare nella 3D Object Recognition, e delinea in primo luogo una panoramica sulle principali rappresentazioni strutturate di dati 3D, le quali rappresentano una prerogativa necessaria per implementare in modo efficiente algoritmi di processing di dati 3D, per poi presentare un nuovo algoritmo di 3D Keypoint Detection che è stato sviluppato e proposto dal Computer Vision Laboratory dell'Università di Bologna presso il quale ho effettuato la mia attività di tesi.

Classification multi-échelle d'images à très haute résolution spatiale basée sur une nouvelle approche texturale

Résumé : Face à l’accroissement de la résolution spatiale des capteurs optiques satellitaires, de nouvelles stratégies doivent être développées pour classifier les images de télédétection. En effet, l’abondance de détails dans ces images diminue fortement l’efficacité des classifications spectrales; de nombreuses méthodes de classification texturale, notamment les approches statistiques, ne sont plus adaptées. À l’inverse, les approches structurelles offrent une ouverture intéressante : ces approches orientées objet consistent à étudier la structure de l’image pour en interpréter le sens. Un algorithme de ce type est proposé dans la première partie de cette thèse. Reposant sur la détection et l’analyse de points-clés (KPC : KeyPoint-based Classification), il offre une solution efficace au problème de la classification d’images à très haute résolution spatiale. Les classifications effectuées sur les données montrent en particulier sa capacité à différencier des textures visuellement similaires. Par ailleurs, il a été montré dans la littérature que la fusion évidentielle, reposant sur la théorie de Dempster-Shafer, est tout à fait adaptée aux images de télédétection en raison de son aptitude à intégrer des concepts tels que l’ambiguïté et l’incertitude. Peu d’études ont en revanche été menées sur l’application de cette théorie à des données texturales complexes telles que celles issues de classifications structurelles. La seconde partie de cette thèse vise à combler ce manque, en s’intéressant à la fusion de classifications KPC multi-échelle par la théorie de Dempster-Shafer. Les tests menés montrent que cette approche multi-échelle permet d’améliorer la classification finale dans le cas où l’image initiale est de faible qualité. De plus, l’étude effectuée met en évidence le potentiel d’amélioration apporté par l’estimation de la fiabilité des classifications intermédiaires, et fournit des pistes pour mener ces estimations.

Deep generative models for facial keypoints detection

A new area of machine learning research called deep learning, has moved machine learning closer to one of its original goals: artificial intelligence and general learning algorithm. The key idea is to pretrain models in completely unsupervised way and finally they can be fine-tuned for the task at hand using supervised learning. In this thesis, a general introduction to deep learning models and algorithms are given and these methods are applied to facial keypoints detection. The task is to predict the positions of 15 keypoints on grayscale face images. Each predicted keypoint is specified by an (x,y) real-valued pair in the space of pixel indices. In experiments, we pretrained deep belief networks (DBN) and finally performed a discriminative fine-tuning. We varied the depth and size of an architecture. We tested both deterministic and sampled hidden activations and the effect of additional unlabeled data on pretraining. The experimental results show that our model provides better results than publicly available benchmarks for the dataset.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Detection of human cytomegalovirus and Epstein-Barr virus in coronary atherosclerotic tissue

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Validity and reliability of methods for the detection of secondary caries around amalgam restorations in primary teeth

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Spatial pattern detection modeling of thrips (Thrips tabaci) on onion fields

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.