Immunochemical detection of UV-induced DNA damage and repair

The application of an antiserum to ultraviolet radiation (UVR)-damaged DNA is presented. A novel experimental system was employed to ascertain the limits of detection for this antiserum. Using a DNA standard containing a known amount of dimer, the limits of detection were found to be 0.9 fmol of dimer. This was compared to a limit of 20-50 fmol dimer using gas chromatography-mass spectrometry (GC-MS). Induction of thymine dimers in DNA following UVR exposure, as assessed using this antiserum in an enzyme-linked immunosorbent assay (ELISA), was compared with GC-MS measurements. The ELISA method successfully demonstrated the induction of lesions in DNA irradiated either with UVC or UVB, although despite high sensitivity, no discernible binding was seen to UVA-irradiated DNA. The antiserum was also shown to be applicable to immunocytochemistry, localising damage in the nuclei of UVR exposed keratinocytes in culture. The ability of the antiserum to detect DNA damage in skin biopsies of individuals exposed to sub-erythemal doses of UVR was also demonstrated. Moreover, the subsequent removal of this damage, as evidenced by a reduction in antiserum staining, was noted in sections of biopsies taken in the hours following irradiation. © 2003 Elsevier B.V. All rights reserved.

Immunochemical detection of glyoxal DNA damage

The relevance of reactive oxygen species (ROS) in the pathogenesis of inflammatory diseases is widely documented. Immunochemical detection of ROS DNA adducts has been developed, however, recognition of glyoxal-DNA adducts has not previously been described. We have generated a polyclonal antibody that has shown increased antibody binding to ROS-modified DNA in comparison to native DNA. In addition, dose-dependent antibody binding to DNA modified with ascorbate alone was shown, with significant inhibition by desferrioxamine, catalase, and ethanol. Minimal inhibition was observed with uric acid, 1,10-phenanthroline and DMSO. However, antibody binding in the presence of EDTA increased 3500-fold. The involvement of hydrogen peroxide and hydroxyl radical in ascorbate-mediated DNA damage is consistent with ascorbate acting as a reducing agent for DNA-bound metal ions. Glyoxal is known to be formed during oxidation of ascorbate. Glyoxylated DNA, that previously had been proposed as a marker of oxidative damage, was recognised in a dose dependent manner using the antibody. We describe the potential use of our anti-ROS DNA antibody, that detects predominantly Fenton-type mediated damage to DNA and report on its specificity for the recognition of glyoxal-DNA adducts.

Immunochemical detection of sequence-specific modifications to DNA induced by UV light

Sequence specificity of antibodies to UV-damaged DNA has not been described previously. The antisera investigated here were specific for UV-modified DNA and were absolutely dependent upon the presence of thymine residues. Using a series of oligonucleotides in competition ELISA, increased inhibition was observed with increasing chain length of UV-polythymidylate. A minimum of three adjacent thymines was required for effective inhibition; alone, dimers of thymine were poor antigens. Although UV-irradiated poly(dC) was not antigenic, cytosines could partially replace thymines within the smallest effective epitope (T-T-T) with a high degree of sequence specificity, not previously described. The main epitope induced by UV was formed from adjacent thymines and either a 3' or a 5' pyrimidine.

An update on genetic, structural and functional studies of arylamine N-acetyltransferases in eucaryotes and procaryotes

Arylamine N-acetyltransferase (NAT) was first identified as the inactivator of the anti-tubercular drug isoniazid, The enzyme was shown to catalyse the transfer of an acetyl group from acetyl-CoA to the terminal nitrogen of the hydrazine drug. The rate of inactivation of isoniazid was polymorphically distributed in the population and was one of the first examples of pharmacogenetic variation, NAT was identified recently in Mycobacterium tuberculosis and is a candidate for; modulating the response to isoniazid, Genome sequences have revealed many homologous members of this unique family of enzymes. The first three-dimensional structure of a member of the NAT family identifies a catalytic triad consisting of aspartate, histidine and cysteine proposed to form the activation mechanism. So far, all procaryotic NATs resemble the human enzyme which acetylates isoniazid (NAT2), Human NAT2 is characteristic of drug-metabolizing enzymes: it is found in liver and intestine, In humans and other mammals, there are up to three different isoenzymes. If only one isoenzyme is present, it is like human NAT1. Human NAT1 and its murine equivalent specifically acetylate the folate catabolite p-amino-benzoylglutamate. NAT1 and its murine homologue each have a ubiquitous tissue distribution and are expressed early in development at the blastocyst stage, During murine embryonic development, NAT is expressed in the developing neural tube. The proposed endogenous role of NAT in folate metabolism, and its multi-allelic nature, indicate that its role in development should be assessed further.

Inactivation of human arylamine N-acetyltransferase 1 by the hydroxylamine of p-aminobenzoic acid

Human N-acetyltransferase 1 (NAT1) is a widely distributed enzyme that catalyses the acetylation of arylamine and hydrazine drugs as well as several known carcinogens, and so its levels in the body may have toxicological importance with regard to drug toxicity and cancer risk. Recently, we showed that p-aminobenzoic acid (PABA) was able to down-regulate human NAT1 in cultured cells, but the exact mechanism by which PABA acts remains unclear. In the present study, we investigated the possibility that PABA-induced down-regulation involves its metabolism to N-OH-PABA, since N-OH-AAF functions as an irreversible inhibitor of hamster and rat NAT1. We show here that N-OH-PABA irreversibly inactivates human NAT1 both in cultured cells and cell cytosols in a time- and concentration-dependent manner. Maximal inactivation in cultured cells occurred within 4 hr of treatment, with a concentration of 30 muM reducing activity by 60 +/- 7%. Dialysis studies showed that inactivation was irreversible, and cofactor (acetyl coenzyme A) but not substrate (PABA) completely protected against inactivation, indicating involvement of the cofactor-binding site. In agreement with these data, kinetic studies revealed a 4-fold increase in cofactor K-m, but no change in substrate K-m for N-OH-PABA-treated cytosols compared to control. We conclude that N-OH-PABA decreases NAT1 activity by a direct interaction with the enzyme and appears to be a result of covalent modification at the cofactor-binding site. This is in contrast to our findings for PABA, which appears to reduce NAT1 activity by down-regulating the enzyme, leading to a decrease in NAT1 protein content. BIOCHEM PHARMACOL 60;12: 1829-1836, 2000. (C) 2000 Elsevier Science Inc.

Immunocytochemical study of Ki-67 as a prognostic marker in canine mammary neoplasia

Background: Canine mammary tumors are challenging for clinicians and pathologists because of complex histologic classification, low specificity of cytologic diagnosis, and unpredictable biological behavior. In histologic specimens, expression of tumor proliferation marker Ki-67, a nuclear nonhistone protein, has been shown to have prognostic value for canine mammary tumors and to correlate with malignancy and low survival rates. Objective: The objective of this study was to measure the proliferation index of canine mammary tumors by immunochemical detection of Ki-67 in cytologic specimens and to determine its relationship to clinical and pathologic variables and patient outcome. Methods: Spontaneous mammary tumors from 31 female dogs were surgically excised. Imprint specimens for cytologic evaluation were wet-fixed in ethanol; histologic specimens were prepared routinely. Immunostaining was performed with the PH 177 monoclonal antibody against Ki-67; proliferation index was graded from negative to +++. Dogs were followed for 18 months. Multivariate logistic regression analysis was used to determine correlations between immunocytochemical results, tumor and clinical variables, and patient outcome. Results: Ki-67 proliferation indices in cytologic specimens were significantly lower for nonmalignant tumors than for malignant tumors. High index values of Ki-67 were positively correlated with metastasis, death from neoplasia, low disease-free survival rates, and low overall survival rate. With the exception of 4 specimens for which cellularity was insufficient, positive expression of Ki-67 in cytologic specimens correlated with that of histologic specimens. Conclusions: The prognostic value of the Ki-67 index in canine mammary tumors by using wet-fixed cytology imprint specimens was similar to that observed previously for histologic specimens. Immunocytochemical detection of Ki-67 could improve the accuracy and value of cytology by providing safe and rapid information about malignancy and patient outcome. © 2004 American Society for Veterinary Clinical Pathology.

Immunohistochemical detection of 4-hydroxynonenal protein adducts in Parkinson disease.

There is growing evidence that oxidative stress and mitochondrial respiratory failure with attendant decrease in energy output are implicated in nigral neuronal death in Parkinson disease (PD). It is not known, however, which cellular elements (neurons or glial cells) are major targets of oxygen-mediated damage. 4-Hydroxy-2-nonenal (HNE) was shown earlier to react with proteins to form stable adducts that can be used as markers of oxidative stress-induced cellular damage. We report here results of immunochemical studies using polyclonal antibodies directed against HNE-protein conjugates to label the site of oxidative damage in control subjects (ages 18-99 years) and seven patients that died of PD (ages 57-78 years). All the nigral melanized neurons in one of the midbrain sections were counted and classified into three groups according to the intensity of immunostaining for HNE-modified proteins--i.e., no staining, weak staining, and intensely positive staining. On average, 58% of nigral neurons were positively stained for HNE-modified proteins in PD; in contrast only 9% of nigral neurons were positive in the control subjects; the difference was statistically significant (Mann-Whitney U test; P < 0.01). In contrast to the substantia nigra, the oculomotor neurons in the same midbrain sections showed no or only weak staining for HNE-modified proteins in both PD and control subjects; young control subjects did not show any immunostaining; however, aged control subjects showed weak staining in the oculomotor nucleus, suggesting age-related accumulation of HNE-modified proteins in the neuron. Our results indicate the presence of oxidative stress within nigral neurons in PD, and this oxidative stress may contribute to nigral cell death.

Development of new immunochemical and spectroscopic analytical methods for the characterization and conservation of works of art

Cultural heritage is constituted by complex and heterogenous materials, such as paintings but also ancient remains. However, all ancient materials are exposed to external environment and their interaction produces different changes due to chemical, physical and biological phenomena. The organic fraction, especially the proteinaceous one, has a crucial role in all these materials: in archaeology proteins reveal human habits, in artworks they disclose technics and help for a correct restoration. For these reasons the development of methods that allow the preservation of the sample as much as possible and a deeper knowledge of the deterioration processes is fundamental. The research activities presented in this PhD thesis have been focused on the development of new immunochemical and spectroscopic approaches in order to detect and identify organic substances in artistic and archaeological samples. Organic components could be present in different cultural heritage materials as constituent element (e.g., binders in paintings, collagen in bones) and their knowledge is fundamental for a complete understanding of past life, degradation processes and appropriate restauration approaches. The combination of immunological approach with a chemiluminescence detection and Laser Ablation-Inductively Coupled Plasma-Mass Spectrometry allowed a sensitive and selective localization of collagen and elements in ancient bones and teeth. Near-infrared spectrometer and hyper spectral imaging have been applied in combination with chemometric data analysis as non-destructive methods for bones prescreening for the localization of collagen. Moreover, an investigation of amino acids in enamel has been proposed, in order to clarify teeth biomolecules survival overtime through the optimization and application of High-Performance Liquid Chromatography on modern and ancient enamel powder. New portable biosensors were developed for ovalbumin identification in paintings, thanks to the combination between biocompatible Gellan gel and electro-immunochemical sensors, to extract and identify painting binders with the contact only between gel and painting and between gel and electrodes.

The Lea Grating Test In Assessing Detection Grating Acuity In Normal Infants Less Than 4 Months Of Age.

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Determination Of Tetrakis(hydroxymethyl)phosphonium Sulfate In Commercial Formulations And Cooling Water By Capillary Electrophoresis With Contactless Conductivity Detection.

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Human Herpesvirus Infections Of The Central Nervous System: Laboratory Diagnosis Based On Dna Detection By Nested Pcr In Plasma And Cerebrospinal Fluid Samples.

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Detection Of Explosives On The Surface Of Banknotes By Raman Hyperspectral Imaging And Independent Component Analysis.

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

A screening method for detection of hexavalent chromium levels in soils

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.