989 resultados para Immature seasonality
Resumo:
In 2000, an outbreak of sylvatic yellow fever possibly occurred in gallery forests of the Grande river in the Paraná basin in the northwestern region of São Paulo state. The aim of this study was to obtain information on the bionomics of Haemagogus and other mosquitoes inside tree holes in that area. Eighteen open tree holes were sampled for immature specimens. Adults were collected twice a month in the forest in Santa Albertina county from July 2000 to June 2001. The seasonal frequency of fourth instars was obtained by the Williams geometric mean (Mw), while the adult frequency was estimated either by hourly arithmetic or the Williams' means. Cole's index was applied to evaluate larval inter-specific associations. Among the ten mosquito species identified, the most abundant was Aedes terrens Walker followed by Sabethes tridentatus Cerqueira and Haemagogus janthinomys Dyar. Larval and adult abundance of these species was higher in summer than in winter. Although larval abundance of Hg. janthinomys peaked in the rainy season, correlation with rainfall was not significant. Six groups of larval associations were distinguished, one of which the most positively stable. The Hg. janthinomys and Ae. terrens association was significant, and Limatus durhamii Theobald was the species with most negative associations.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.
Resumo:
OBJECTIVE: To evaluate suicide seasonality in the city of São Paulo within an urban area and tropical zone. METHOD: Suicides were evaluated using the chi-square test and analysis of variance (ANOVA) by comparing monthly, quarterly and half-yearly variations, differentiating by gender. Analyses of time series were carried out using the autocorrelation function and periodogram, while the significance level for seasonality was confirmed with the Fisher's test. RESULTS: The suicides of the period between 1979 and 2003 numbered 11,434 cases. Differences were observed in suicides occurring in Spring and Autumn for the total sample (ANOVA: p-value = 0.01), and in the male sample (ANOVA: p-value = 0.02). For the analysis of time series, seasonality was significant only for the period of 7 months in the male sample (p-value = 0.04). DISCUSSION: In this study, no significant seasonal differences were observed in the occurrences of suicides, with the exception of the male sample. The differences observed did not correspond with the pattern described in studies carried out in temperate zones. Some of the climatic particularities of the tropical zone might explain the atypical pattern of seasonality of suicides found in large populations within an urban area and tropical zone.
Resumo:
The objective of this study was to evaluate the effect of genetic polymorphism of kappa-casein, breed and seasonality on the physicochemical characteristics, composition and stability of milk in commercial dairy herds. A total of 879 milk and blood samples were collected from 603 Holstein and 276 Girolando cows, obtained during rainy and dry seasons. Milk samples were analyzed to determine the physicochemical characteristics, composition and ethanol stability, while blood samples were subjected to polymerase chain reaction to identify the kappa-casein genotype. The frequencies of genotypes AA, AB and BB of k-casein were respectively, 66.83, 31.84 and 1.33% for Holstein, and 71.38, 27.90 and 0.72% for the Girolando cows, respectively. The A allele was more frequent than the B allele, both for Holstein (0.827 and 0.173) and Girolando cows (0.853 and 0.147), respectively. Cows of AB and BB genotypes showed a higher milk fat content compared to the AA genotype. There was an interaction between breed and seasonality on the concentration of milk urea with higher values for Holstein and Girolando cows in the rainy and dry season, respectively. The levels of lactose, total solids, crude protein, true protein, casein and the casein:true protein ratio were higher during the dry season, while during the rainy season, the somatic cell count and milk urea concentration were higher. There was no association between milk stability and k-casein genotypes, but Holstein cows showed higher milk stability than Girolando cows, and milk was more stable during the rainy season than during the dry season.
Resumo:
Baccharis dracunculifolia is the source of Brazilian green propolis (BGP). Considering the broad spectrum of biological activities attributed to green proplis, B. dracunculifolia has a great potential for the development of new cosmetic and pharmaceutical products. In this work, the cultivation of 10 different populations of native B. dracunculifolia had been undertaken aiming to determine the role of seasonality on its phenolic compounds. For this purpose, fruits of this plant were collected from populations of 10 different regions, and 100 individuals of each population were cultivated in an experimental area of 1800 m(2). With respect to cultivation, the yields of dry plant, essential oil and crude extract were measured monthly resulting in mean values of 399 +/- 80 g, 0.6 +/- 0.1% and 20 +/- 4%, respectively. The HPLC analysis allowed detecting seven phenolic compounds: caffeic acid, ferulic acid, aromadendrin-4'-methyl ether (AME), isosakuranetin, artepillin C, baccharin and 2-dimethyl-6-carboxyethenyl-2H-1-benzopyran acid, which were the major ones throughout the 1-year monthly analysis. Caffeic acid was detected in all cultivated populations with mean of 4.0%. AME displayed the wide variation in relation to other compounds showing means values of 0.65 +/- 0.13% at last quarter. Isosakuranetin and artepillin C showed increasing concentrations with values between 0% and 1.4% and 0% and 1.09%, respectively. The obtained results allow suggesting that the best time for harvesting this plant, in order to obtain good qualitative and quantitative results for these phenolic compounds, is between December and April.
Resumo:
Background: Without intensive selection, the majority of bovine oocytes submitted to in vitro embryo production (IVP) fail to develop to the blastocyst stage. This is attributed partly to their maturation status and competences. Using the Affymetrix GeneChip Bovine Genome Array, global mRNA expression analysis of immature (GV) and in vitro matured (IVM) bovine oocytes was carried out to characterize the transcriptome of bovine oocytes and then use a variety of approaches to determine whether the observed transcriptional changes during IVM was real or an artifact of the techniques used during analysis. Results: 8489 transcripts were detected across the two oocyte groups, of which similar to 25.0% (2117 transcripts) were differentially expressed (p < 0.001); corresponding to 589 over-expressed and 1528 under-expressed transcripts in the IVM oocytes compared to their immature counterparts. Over expression of transcripts by IVM oocytes is particularly interesting, therefore, a variety of approaches were employed to determine whether the observed transcriptional changes during IVM were real or an artifact of the techniques used during analysis, including the analysis of transcript abundance in oocytes in vitro matured in the presence of a-amanitin. Subsets of the differentially expressed genes were also validated by quantitative real-time PCR (qPCR) and the gene expression data was classified according to gene ontology and pathway enrichment. Numerous cell cycle linked (CDC2, CDK5, CDK8, HSPA2, MAPK14, TXNL4B), molecular transport (STX5, STX17, SEC22A, SEC22B), and differentiation (NACA) related genes were found to be among the several over-expressed transcripts in GV oocytes compared to the matured counterparts, while ANXA1, PLAU, STC1and LUM were among the over-expressed genes after oocyte maturation. Conclusion: Using sequential experiments, we have shown and confirmed transcriptional changes during oocyte maturation. This dataset provides a unique reference resource for studies concerned with the molecular mechanisms controlling oocyte meiotic maturation in cattle, addresses the existing conflicting issue of transcription during meiotic maturation and contributes to the global goal of improving assisted reproductive technology.
Resumo:
Ticks are blood-feeding arthropods that secrete immunomodulatory molecules through their saliva to antagonize host inflammatory and immune responses. As dendritic cells (DCs) play a major role in host immune responses, we studied the effects of Rhipicephalus sanguineus tick saliva on DC migration and function. Bone marrow-derived immature DCs pre-exposed to tick saliva showed reduced migration towards macrophage inflammatory protein (MIP)-1 alpha, MIP-1 beta and regulated upon activation, normal T cell expressed and secreted (RANTES) chemokines in a Boyden microchamber assay. This inhibition was mediated by saliva which significantly reduced the percentage and the average cell-surface expression of CC chemokine receptor CCR5. In contrast, saliva did not alter migration of DCs towards MIP-3 beta, not even if the cells were induced for maturation. Next, we evaluated the effect of tick saliva on the activity of chemokines related to DC migration and showed that tick saliva per se inhibits the chemotactic function of MIP-1 alpha, while it did not affect RANTES, MIP-1 beta and MIP-3 beta. These data suggest that saliva possibly reduces immature DC migration, while mature DC chemotaxis remains unaffected. In support of this, we have analyzed the percentage of DCs on mice 48 h after intradermal inoculation with saliva and found that the DC turnover in the skin was reduced compared with controls. Finally, to test the biological activity of the saliva-exposed DCs, we transferred DCs pre-cultured with saliva and loaded with the keyhole limpet haemocyanin (KLH) antigen to mice and measured their capacity to induce specific T cell cytokines. Data showed that saliva reduced the synthesis of both T helper (Th)1 and Th2 cytokines, suggesting the induction of a non-polarised T cell response. These findings propose that the inhibition of DCs migratory ability and function may be a relevant mechanism used by ticks to subvert the immune response of the host. (c) 2007 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.
Resumo:
The objective of this work was to carry a descriptive analysis in the monthly precipitation of rainfall stations from Rio de Janeiro State, Brazil, using data of position and dispersion and graphical analyses, and to verify the presence of seasonality and trend in these data, with a study about the application of models of time series. The descriptive statistics was to characterize the general behavior of the series in three stations selected which present consistent historical series. The methodology of analysis of variance in randomized blocks and the determination of models of multiple linear regression, considering years and months as predictors variables, disclosed the presence of seasonality, what allowed to infer on the occurrence of repetitive natural phenomena throughout the time and absence of trend in the data. It was applied the methodology of multiple linear regression to removal the seasonality of these time series. The original data had been deducted from the estimates made by the adjusted model and the analysis of variance in randomized blocks for the residues of regression was preceded again. With the results obtained it was possible to conclude that the monthly rainfall present seasonality and they don`t present trend, the analysis of multiple regression was efficient in the removal of the seasonality, and the rainfall can be studied by means of time series.
Resumo:
The reactive oxygen species (ROS) produced by neutrophils are involved in the pathogenesis of several diseases, for which the intake of antioxidants could benefit patients either as a prophylactic or therapeutic treatment. Propolis is among the known antioxidants, and its chemical composition may vary under the influence of seasonality, which may interfere in its biological properties. This work evaluates the role of seasonality on the production of some important compounds of propolis samples produced monthly from November 2001 through October 2002 as well as the effect of these samples on the oxidative metabolism of stimulated neutrophils, by using both luminol and lucigenin to produce chemiluminescence (CLlum and CLluc, respectively). The cytotoxicity of the most active extracts to neutrophils was also investigated. The inhibitory effect of the propolis samples varied significantly during the studied period for both assays (3.4 +/- 1.1 to 16.0 +/- 1.1 mu g/mL for CLlum and 6.2 +/- 2.0 to 30.0 +/- 5.0 mu g/mL for CLluc), which was also observed in the quantitative profile of the main analyzed compounds (aromadendrin-4`-methyl ether, artepillin C, and baccharin). This effect started to become more prominent during the fall and, among all the studied extracts, the one obtained in May displayed the highest inhibitory effect on CL production (3.4 +/- 1.1 mu g/mL for alum and 6.2 +/- 2.0 mu g/mL for CLluc). The HPLC qualitative profiles of the extracts of propolis samples were quite similar, but there was a huge variation in terms of quantitative profile. It seems that aromadendrin-4`-methyl ether and baccharin play an essential role in the antioxidant activity, while artepillin C is not very important for this effect. The extracts presenting the highest antioxidant activity were produced in May, June, and August, and they did not display cytotoxicity at 25 mu g/mL; quercetin, used as control, was not toxic to neutrophils at 8.5 mu g/mL (C) 2010 Elsevier B.V. All rights reserved.
Resumo:
Objective: To evaluate the impact of increasing the minimum resupply period for prescriptions on the Pharmaceutical Benefits Scheme (PBS) in November 1994. The intervention was designed to reduce the stockpiling of medicines used for chronic medical conditions under the PBS safety net. Methods: Interrupted times series regression analyses were performed on 114 months of PBS drug utilisation data from January 1991 to June 2000. These analyses assessed whether there had been a significant interaction between the onset of the intervention in November 1994 and the extreme levels of drug utilisation in the months of December (peak utilisation) and January (lowest utilisation) respectively. Both serial and 12-month lag autocorrelations were controlled for. Results: The onset of the intervention was associated with a significant reduction in the December peak in drug utilisation; after the introduction of the policy there were 1,150,196 fewer proscriptions on average or that month (95% Cl 708,333-1,592,059). There was, however, no significant change in the low level of utilisation in January. The effect of the policy appears to be decreasing across successive postintervention years. though the odds of a prescription being dispensed in December remained significantly lower in 1999 compared to each of the pre-intervention years (11% vs. 14%) Conclusion: Analysis of the impact of increasing the re-supply period for PBS prescriptions showed that the magnitude of peak utilisation in December had been markedly reduced by the policy, though this effect appears to be decreasing over time. Continued monitoring and policy review is warranted in order to ensure that the initial effect of the intervention be maintained.
Resumo:
Dendritic cells (DCs) have been thought to follow a life history, typified by Langerhans cells (LCs), with 2 major developmental stages: an immature stage that captures antigens in the periphery and a mature stage that presents those antigens in the lymphoid organs. However, a systematic assessment of the maturity of lymphoid organ DCs has been lacking. We have analyzed the maturity of the DC types found in the steady state in the spleen, lymph nodes (LNs), and thymus. The DCs that migrate into the iliac, mesenteric, mediastinal, or subcutaneous LNs from peripheral tissues were mature and therefore could not process and present newly encountered antigens. However, all the other DC types were phenotypically and functionally immature: they expressed low levels of surface major histocompatibility complex class 11 (MHC 11) and CD86, accumulated MHC 11 in their endosomes, and could present newly encountered antigens. These immature DCs could 1346 induced to mature by culture in vitro or by Inoculation of inflammatory stimuli in vivo. Therefore, the lymphoid organs contain a large cohort of immature DCs, most likely for the maintenance of peripheral tolerance, which can respond to infections reaching those organs and mature in situ. (C) 2003 by The American Society of Hematology.
Resumo:
Previous study revealed that the swarm-founding wasp Polybia paulista is accurately able to distinguish nestmates from non-nestmates in the summer. However, the risk of accepting alien intruders is considered to be low in winter colonies, and additionally brood production is limited in 30-40% of colonies during the winter in this species. Thus, it is expected that colonies might lower their acceptance threshold and accept some conspecific wasps from alien colonies in winter. We conducted field experiments to examine tolerance of conspecific (nestmate and non-nestmate) females in winter. In contrast to our prediction, our colonies did not accept any individuals from alien colonies. We suggest that P. paulista exhibits the colony-specific acceptance threshold in winter, and colonies that produced brood in their nests may have raised the acceptance threshold even if the risk of accepting alien intruders is low in winter.
Resumo:
The endemic Neotropical long-horned caddisfly subgenus Notalina (Neonotalina) Holzenthal contains nine described species, but its immature stages are unknown. In this paper the larvae and pupae of Notalina morsei Holzenthal 1986 from southeastern Brazil are described and illustrated. Larvae of the subgenus are easily recognized from other Neotropical leptocerids by the following characters: ventral apotome which is broad anteriorly and narrow posteriorly; the metanotum with three sclerites; the metasternum bearing 10-12 setae; the gill arrangement, usually including ventral and dorsal filaments from abdominal segments II to VI; and abdominal tergite IX with 6 long and 4 short setae. An updated key to known larvae of Neotropical Leptoceridae genera is provided.
Resumo:
Inhibition of NFkB by the compound Bay 11–7082 (Bay) induces tolerogenic properties in dendritic cells (DC). While activation of NFkB can be induced by reactive oxygen species (ROS) and thiol/disulfide redox states, the consequences of NFkB blockade on ROS/redox state is not known. To generate immature DC, monocytes were cultured in GM-CSF and IL-4 (with or without Bay) for 48 h. Genes potentially involved in redox regulation were determined using microarray technology and validated using FACS, real-time PCR or western blotting. ROS were measured using two fluorescent dyes DHR-123 and DHE (to detect H2O2 or O2 respectively). We found increased expression of genes associated with reductants such as thioredoxin reductase (TrxR1) and glutathione (GSH), although those associated with the breakdown of H2O2 such as glutathione peroxidase, peroxiredoxins and catalase were decreased. Interestingly, Bay-treated DC produced less ROS in comparison to control DC under basal conditions and following stimulation with various pro-oxidants. In conclusion, Bay-treated DC display not only tolerogenic properties but also an intracellular reducing environment and an impaired ability to produce ROS. We are currently investigating whether exogenous ROS can interfere with the tolerogenic properties of Bay-treated DC.