962 resultados para IMMATURE STAGES


Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The endemic Neotropical long-horned caddisfly subgenus Notalina (Neonotalina) Holzenthal contains nine described species, but its immature stages are unknown. In this paper the larvae and pupae of Notalina morsei Holzenthal 1986 from southeastern Brazil are described and illustrated. Larvae of the subgenus are easily recognized from other Neotropical leptocerids by the following characters: ventral apotome which is broad anteriorly and narrow posteriorly; the metanotum with three sclerites; the metasternum bearing 10-12 setae; the gill arrangement, usually including ventral and dorsal filaments from abdominal segments II to VI; and abdominal tergite IX with 6 long and 4 short setae. An updated key to known larvae of Neotropical Leptoceridae genera is provided.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

This work reports free-living opossums (Didelphis aurita and Didelphis albiventris) and a rodent species (Thrichomys laurentius) naturally infested by the immature stages of Amblyomma fuscum Neumann, 1907 in Brazil. Previously the only host record for the A. fuscum immature stages was for a single nymph collected on an opossum D. aurita in the state of Sao Paulo. Herein are presented two new host records (D. albiventris and T. laurentius) for A. fuscum. Our results indicate that opossums (Didelphis spp.), and one small rodent species (T. laurentius) are major hosts for immature stages of A. fuscum in Brazil. Based on the known feeding habits of immature stages of A. fuscum. coupled with previous reports of the adult stage parasitizing humans, A. fuscum is a potential vector of spotted fever group rickettsiae.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

A relation between a rice irrigation system and mosquito breeding was established in a study undertaken at the Ribeira Valley Experimental Station, from January through December 1992. Flooding favoured Anopheles (Nyssorhynchus) and Culex (Melanoconion) species, while empty paddies condition were propitious to Aedes scapularis and Culex (Culex) species. Compared with a more primitive area of the same region, several species showed high a degree of adaptation to the anthropic environment. Among them, Anopheles albitarsis, a potential malaria vector that breeds in the irrigation system, has shown immature stage production thirteen times higher than at the natural breeding sites. In addition, Ae. scapularis, An. oswaldoi, Cx. bastagarius, and Cx. chidesteri presented high levels of synanthropy.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

ABSTRACT The biology and morphology of the immature stages of Heliconius sara apseudes (Hübner, [1813]) are still little known. External features of the egg, larvae and pupa of H. sara apseudes are described and illustrated, based upon light and scanning electron microscopy. Eggs with smooth carina, first instar larva with scaly setae, and body of second to fifth instars covered with scattered pinnacles distinguish H. sara apseudes from other heliconiine species.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Under laboratory conditions, the development from egg to adult of P. wellcomei takes an average of 42 days. The larval tages are similar to those of P. arthuri, described by barretto (1941), but can be distinguished from this species by the ratio of the first to second antennal segment, by the form of the lateral head seate and prothoracic dorsolateral setae. The pupal stage of P. wellcomei is characterized by a trifid pre-alar seta and simple spine-like thoracic and abdominal setae.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The fourth-instar larva and pupa of Psorophora pseudomelanota Barata & Cotrim, 1971 and Phoniomyia deanei Lourenço-de-Oliveira, 1983 are described and compared with those of related species.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Eggs, immature mosquito collections were made at Cosquin, La Calera ( Chaco phytogeographic region), Villa Allende and Villa del Rosario (Espinal phytogeographic region) during April/September of two consecutive years 1989, 1990. Specific immature habitats in each locality were identified and sampled monthly. Eggs and/or immatures of Aedes albifasciatus, Ae. fluviatilis, Anopheles albitarsis, culex acharistus, Cx. apicinus, Cx. bidens, Cx. coronator, Cx. chidesteri, Cx. dolosus, Cx. maxi, Cx. quinquefasciatus, Cx. saltanensis, Psorophora ciliata and Uranotaenia lowii were collected. Three species (Cx. acharistus, Cx. dolosus and Cx. quinquefasciatus) were collected during the sampling period for all developmental stages. This suggests that immature of these species do not overwinter but continue to develop throughout the cold autumn and winter seasons.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

Larva and pupa of Myiotabanus barrettoi living between leaves of Pistia stratiotes in ponds of Formosa Province (Argentina) are described. As immature stages of Lepiselaga crassipes inhabit the same environment and have very a similar appearance, new information on ornamentation and morphology is added to differentiate both species. Larvae and pupae were maintained individually in moist vials at laboratory temperature until adults emerged.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The larval and pupal stages of Anopheles (Nyssorhynchus) rondoni (Neiva and Pinto) (Albimanus Section) are fully described and illustrated for the first time. The larval stage is similar to An. (Nys.) strodei Root. It can be recognized by the following combination of characters: clypeal index, 1.6-2.9; single, aciculate setae 2,3-C; seta 3-C 0.5-0.7 the length of 2-C; setae 1,2-P rarely sharing a common tubercle; seta 1-P with narrow leaflets. The pupal stage is distinguished from other Nyssorhynchus by having setae 1-IV-VII and 5-V-VII branched. Only minor variation was found in setal counts between specimens from Peixoto de Azevedo, State of Mato Grosso and Bocaina, State of São Paulo, Brazil

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The second and third instar larvae, and the pupa of Metacuterebra apicalis (Guérin-Menevilli), are described based on light and scanning electron microscope observations

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The terrestrial immature stages of the Chilean horse fly, Protodasyapha (Protodasyapha) hirtuosa (Philippi), are described. P.(P.) hirtuosa resembles Ectenopsis vulpecula Macquart and Caenoprosopon trichocera (Bigot) from Australia, and Esenbeckia delta Hine from North America, in both the larval and pupal stages. Some characters that are shared between these species are unique and provide evidence of their monophyletic origin. Larvae of P. hirtuosa were found 3-5 below of the soil surface and associated with larvae of Coleoptera, Lepidoptera and Diptera.

Relevância:

100.00% 100.00%

Publicador:

Resumo:

The larva and pupa of Culex (Melanoconion) ocossa Dyar & Knab are redescribed and those of Culex (Melanoconion) delpontei Duret and Culex (Melanoconion) pereyrai Duret are described from specimens collected in the states of São Paulo and Paraná, Brazil. The pupa of Cx. ocossa differs from those of the other two species in having seta 5-IV-VI dark with strongly aciculated branches, and caudolateral angle of segment VIII produced into sharp point, and seta 1-P present; Cx. delpontei can be distinguished from Cx. pereyrai in possessing paddle lightly tanned, trumpet flared, and wing and leg cases lightly tanned, without pattern of dark spots; Cx. pereyrai can be recognized by having wing case with pattern of dark, discontinuously pigmented, longitudinal lines, and trumpet cylindrical, not flared. The larvae of the three species share the presence of seta 2-C placed medially to seta 1-C.