Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Immature stages of the moth Lobeza dentilinea (Lepidoptera: Notodontidae), with redescription of the species based on male and female morphology

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Sequential analysis of global gene expression profiles in immature and in vitro matured bovine oocytes: potential molecular markers of oocyte maturation

Background: Without intensive selection, the majority of bovine oocytes submitted to in vitro embryo production (IVP) fail to develop to the blastocyst stage. This is attributed partly to their maturation status and competences. Using the Affymetrix GeneChip Bovine Genome Array, global mRNA expression analysis of immature (GV) and in vitro matured (IVM) bovine oocytes was carried out to characterize the transcriptome of bovine oocytes and then use a variety of approaches to determine whether the observed transcriptional changes during IVM was real or an artifact of the techniques used during analysis. Results: 8489 transcripts were detected across the two oocyte groups, of which similar to 25.0% (2117 transcripts) were differentially expressed (p < 0.001); corresponding to 589 over-expressed and 1528 under-expressed transcripts in the IVM oocytes compared to their immature counterparts. Over expression of transcripts by IVM oocytes is particularly interesting, therefore, a variety of approaches were employed to determine whether the observed transcriptional changes during IVM were real or an artifact of the techniques used during analysis, including the analysis of transcript abundance in oocytes in vitro matured in the presence of a-amanitin. Subsets of the differentially expressed genes were also validated by quantitative real-time PCR (qPCR) and the gene expression data was classified according to gene ontology and pathway enrichment. Numerous cell cycle linked (CDC2, CDK5, CDK8, HSPA2, MAPK14, TXNL4B), molecular transport (STX5, STX17, SEC22A, SEC22B), and differentiation (NACA) related genes were found to be among the several over-expressed transcripts in GV oocytes compared to the matured counterparts, while ANXA1, PLAU, STC1and LUM were among the over-expressed genes after oocyte maturation. Conclusion: Using sequential experiments, we have shown and confirmed transcriptional changes during oocyte maturation. This dataset provides a unique reference resource for studies concerned with the molecular mechanisms controlling oocyte meiotic maturation in cattle, addresses the existing conflicting issue of transcription during meiotic maturation and contributes to the global goal of improving assisted reproductive technology.

Tick saliva inhibits the chemotactic function of MIP-1 alpha and selectively impairs chemotaxis of immature dendritic cells by down-regulating cell-surface CCR5

Ticks are blood-feeding arthropods that secrete immunomodulatory molecules through their saliva to antagonize host inflammatory and immune responses. As dendritic cells (DCs) play a major role in host immune responses, we studied the effects of Rhipicephalus sanguineus tick saliva on DC migration and function. Bone marrow-derived immature DCs pre-exposed to tick saliva showed reduced migration towards macrophage inflammatory protein (MIP)-1 alpha, MIP-1 beta and regulated upon activation, normal T cell expressed and secreted (RANTES) chemokines in a Boyden microchamber assay. This inhibition was mediated by saliva which significantly reduced the percentage and the average cell-surface expression of CC chemokine receptor CCR5. In contrast, saliva did not alter migration of DCs towards MIP-3 beta, not even if the cells were induced for maturation. Next, we evaluated the effect of tick saliva on the activity of chemokines related to DC migration and showed that tick saliva per se inhibits the chemotactic function of MIP-1 alpha, while it did not affect RANTES, MIP-1 beta and MIP-3 beta. These data suggest that saliva possibly reduces immature DC migration, while mature DC chemotaxis remains unaffected. In support of this, we have analyzed the percentage of DCs on mice 48 h after intradermal inoculation with saliva and found that the DC turnover in the skin was reduced compared with controls. Finally, to test the biological activity of the saliva-exposed DCs, we transferred DCs pre-cultured with saliva and loaded with the keyhole limpet haemocyanin (KLH) antigen to mice and measured their capacity to induce specific T cell cytokines. Data showed that saliva reduced the synthesis of both T helper (Th)1 and Th2 cytokines, suggesting the induction of a non-polarised T cell response. These findings propose that the inhibition of DCs migratory ability and function may be a relevant mechanism used by ticks to subvert the immune response of the host. (c) 2007 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved.

Most lymphoid organ dendritic cell types are phenotypically and functionally immature

Dendritic cells (DCs) have been thought to follow a life history, typified by Langerhans cells (LCs), with 2 major developmental stages: an immature stage that captures antigens in the periphery and a mature stage that presents those antigens in the lymphoid organs. However, a systematic assessment of the maturity of lymphoid organ DCs has been lacking. We have analyzed the maturity of the DC types found in the steady state in the spleen, lymph nodes (LNs), and thymus. The DCs that migrate into the iliac, mesenteric, mediastinal, or subcutaneous LNs from peripheral tissues were mature and therefore could not process and present newly encountered antigens. However, all the other DC types were phenotypically and functionally immature: they expressed low levels of surface major histocompatibility complex class 11 (MHC 11) and CD86, accumulated MHC 11 in their endosomes, and could present newly encountered antigens. These immature DCs could 1346 induced to mature by culture in vitro or by Inoculation of inflammatory stimuli in vivo. Therefore, the lymphoid organs contain a large cohort of immature DCs, most likely for the maintenance of peripheral tolerance, which can respond to infections reaching those organs and mature in situ. (C) 2003 by The American Society of Hematology.

Description of the immature stages of Notalina morsei Holzenthal, 1986 (Trichoptera : Leptoceridae) and an updated key to larvae of Neotropical Leptoceridae genera

The endemic Neotropical long-horned caddisfly subgenus Notalina (Neonotalina) Holzenthal contains nine described species, but its immature stages are unknown. In this paper the larvae and pupae of Notalina morsei Holzenthal 1986 from southeastern Brazil are described and illustrated. Larvae of the subgenus are easily recognized from other Neotropical leptocerids by the following characters: ventral apotome which is broad anteriorly and narrow posteriorly; the metanotum with three sclerites; the metasternum bearing 10-12 setae; the gill arrangement, usually including ventral and dorsal filaments from abdominal segments II to VI; and abdominal tergite IX with 6 long and 4 short setae. An updated key to known larvae of Neotropical Leptoceridae genera is provided.

Inhibition of NF kappa B leads to an intracellular reducing environment in human monocyte-derived immature dendritic cells

Inhibition of NFkB by the compound Bay 11–7082 (Bay) induces tolerogenic properties in dendritic cells (DC). While activation of NFkB can be induced by reactive oxygen species (ROS) and thiol/disulfide redox states, the consequences of NFkB blockade on ROS/redox state is not known. To generate immature DC, monocytes were cultured in GM-CSF and IL-4 (with or without Bay) for 48 h. Genes potentially involved in redox regulation were determined using microarray technology and validated using FACS, real-time PCR or western blotting. ROS were measured using two fluorescent dyes DHR-123 and DHE (to detect H2O2 or O2 respectively). We found increased expression of genes associated with reductants such as thioredoxin reductase (TrxR1) and glutathione (GSH), although those associated with the breakdown of H2O2 such as glutathione peroxidase, peroxiredoxins and catalase were decreased. Interestingly, Bay-treated DC produced less ROS in comparison to control DC under basal conditions and following stimulation with various pro-oxidants. In conclusion, Bay-treated DC display not only tolerogenic properties but also an intracellular reducing environment and an impaired ability to produce ROS. We are currently investigating whether exogenous ROS can interfere with the tolerogenic properties of Bay-treated DC.

HOST RECORDS FOR THE IMMATURE STAGES OF THE SOUTH AMERICAN TICK, AMBLYOMMA FUSCUM (ACARI: IXODIDAE)

This work reports free-living opossums (Didelphis aurita and Didelphis albiventris) and a rodent species (Thrichomys laurentius) naturally infested by the immature stages of Amblyomma fuscum Neumann, 1907 in Brazil. Previously the only host record for the A. fuscum immature stages was for a single nymph collected on an opossum D. aurita in the state of Sao Paulo. Herein are presented two new host records (D. albiventris and T. laurentius) for A. fuscum. Our results indicate that opossums (Didelphis spp.), and one small rodent species (T. laurentius) are major hosts for immature stages of A. fuscum in Brazil. Based on the known feeding habits of immature stages of A. fuscum. coupled with previous reports of the adult stage parasitizing humans, A. fuscum is a potential vector of spotted fever group rickettsiae.

Vitrification with Glutamine Improves Maturation Rate of Vitrified/Warmed Immature Bovine Oocytes

Contents The current study examined the protective effects of l-glutamine and cytochalasin B during vitrification of immature bovine oocytes. Oocyte vitrification solution (PBS supplemented with 10% FCS, 25% EG, 25% DMSO and 0.5 m trehalose) was the vitrification control. Treatments were the addition of 7 mu g/ml cytochalasin B, 80 mm glutamine or both cytochalasin and glutaminine for 30 s. After warming, oocytes were matured in vitro for 24 h, fixed and stained with Hoechst (33342) for nuclear maturation evaluation. l-glutamine improved the vitrified/warmed immature bovine oocytes viability (32.8%), increasing the nuclear maturation rates compared to other treatments and the no treatment vitrified control (17.4%). There was, however, no effect of cytochalasin B on in vitro maturation (14.4%).

Human immature dental pulp stem cells` contribution to developing mouse embryos: production of human/mouse preterm chimaeras

In this study, we aimed at determining whether human immature dental pulp stem cells (hIDPSC) would be able to contribute to different cell types in mouse blastocysts without damaging them. Also, we analysed whether these blastocysts would progress further into embryogenesis when implanted to the uterus of foster mice, and develop human/mouse chimaera with retention of hIDPSC derivates and their differentiation. hIDPSC and mouse blastocysts were used in this study. Fluorescence staining of hIDPSC and injection into mouse blastocysts, was performed. Histology, immunohistochemistry, fluorescence in situ hybridization and confocal microscopy were carried out. hIDPSC showed biological compatibility with the mouse host environment and could survive, proliferate and contribute to the inner cell mass as well as to the trophoblast cell layer after introduction into early mouse embryos (n = 28), which achieved the hatching stage following 24 and 48 h in culture. When transferred to foster mice (n = 5), these blastocysts with hIDPSC (n = 57) yielded embryos (n = 3) and foetuses (n = 6); demonstrating presence of human cells in various organs, such as brain, liver, intestine and hearts, of the human/mouse chimaeras. We verified whether hIDPSC would also be able to differentiate into specific cell types in the mouse environment. Contribution of hIDPSC in at least two types of tissues (muscles and epithelial), was confirmed. We showed that hIDPSC survived, proliferated and differentiated in mouse developing blastocysts and were capable of producing human/mouse chimaeras.

Effects of seawater components on immature Culicoides molestus (Skuse) (Diptera : Ceratopogonidae)

Following analysis of beach sites and an indication that seawater components might influence larval occurrence, we studied the impact of increasing salinity and seawater concentration on survival of fourth-instar larvae of the canal biting midge, Culicoides molestus . While NaCl had little effect on immature survival, increasing the concentration of seawater increased mortality prior to the adult stage. Seawater at three and four times the normal concentration killed all immatures. Artificial elevation of seawater concentration in the sandy substrate preferred by larvae, therefore, has the potential to reduce immature midge survival. Diet also affected survival, with higher mortality of immatures that were fed fish-food flakes compared with those that were fed live nematodes.

Occurrence of immature Culicoides molestus (Skuse) (Diptera : Ceratopogonidae) in relation to habitat characteristics

Analysis of beach sites on the Gold Coast, Australia, found that 14 physical and chemical habitat characteristics differed significantly between sites where numerous immatures of the canal biting midge, Culicoides molestus (Skuse), were found and sites where no midge immatures occurred. Five of the chemical factors found to reliably distinguish C. molestus habitat are major components of seawater, while another, electrical conductivity, is related to the concentration of seawater components. Calcium was the only one of the six primary components of seawater that was not a statistically significant correlate of C. molestus habitation by sand analysis. It is likely that a causative variable in occurrence of immatures is the concentration of seawater present in canals, because larvae are found where seawater component concentration is low in relation to uninhabited sites of similar appearance.

Studies on mosquitoes (Diptera: Culicidae) and anthropic environment: 2 - Immature stages research at a rice irrigation system location in South-Eastern Brazil

A relation between a rice irrigation system and mosquito breeding was established in a study undertaken at the Ribeira Valley Experimental Station, from January through December 1992. Flooding favoured Anopheles (Nyssorhynchus) and Culex (Melanoconion) species, while empty paddies condition were propitious to Aedes scapularis and Culex (Culex) species. Compared with a more primitive area of the same region, several species showed high a degree of adaptation to the anthropic environment. Among them, Anopheles albitarsis, a potential malaria vector that breeds in the irrigation system, has shown immature stage production thirteen times higher than at the natural breeding sites. In addition, Ae. scapularis, An. oswaldoi, Cx. bastagarius, and Cx. chidesteri presented high levels of synanthropy.

Observations on the miraxonal attraction exercised by sexually immature or adult Biomphalaria glabrata infected or not by Schistosoma mansoni

OBJECTIVE: The influence of age and the presence of secondary sporocysts in the miraxonal attraction exercised by Biomphalaria glabrata on miracidia of Schistosoma mansoni of the BH strain were studied. MATERIAL AND METHOD: A glass apparatus containing two compartments joined by a tube and previously tested in other experiments, was used. Specimens of B. glabrata or its snail conditioned water (SCW) selected before the first oviposition (sexually immature), after the first oviposition (adult), with or without secondary sporocysts, were used to attract the miracidia. RESULTS: It was noted that snails or their SCW containing secondary sporocysts lost the ability to attract miracidia. The sexual maturity of the snail did not influence miraxonal attraction.

Affinity and diversity indices for anopheline immature forms

As for the entire Amazon Region, malaria continues to be a major health public problem in Roraima that presented an Annual Parasitic Index of 85.4 in 2005, the highest in Brazil. Information on anopheline breeding sites is an essential component in malaria control strategies. Aiming to contribute to the limited knowledge on anopheline immature forms in Roraima, collections and breeding site observations were performed in 10 breeding sites around the capital city Boa Vista. Collections were carried out in the rainy and dry season periods between April 2004 and January 2005. Breeding sites comprised natural and artificial water reservoirs. A total of 623 immature forms were collected belonging to Anopheles albitarsis s.l., An.triannulatus s.l., An. nuneztovari/dunhami, An. braziliensis, An. evansae, An. oswaldoi s.l., An. strodei and An. darlingi. An. albitarsis and An. braziliensis were the most frequently found species. Eight larvae of An. darlingi were found in only one breeding site located in the forest. An. triannulatus/An. nuneztovari and An. albitarsis/An. braziliensis were the pairs of species that mostly occurred together. Both pair of species displayed the highest affinity index what might indicate a high compatibility for the same breeding conditions and/or a synergistic co-occurrence. Species diversity index was higher for the dry season.