841 resultados para Hazardous events
Resumo:
Dissertação de mestrado integrado em Engenharia Civil
Resumo:
Explosive cyclones are intense extra-tropical low pressure systems featuring large deepening rates. In the Euro-Atlantic sector, they are a major source of life-threatening weather impacts due to their associated strong wind gusts, heavy precipitation and storm surges. The wintertime variability of the North Atlantic cyclonic activity is primarily modulated by the North Atlantic Oscillation (NAO). In this study, we investigate the interannual and multi-decadal variability of explosive North Atlantic cyclones using track density data from two reanalysis datasets (NCEP and ERA-40) and a control simulation of an atmosphere/ocean coupled General Circulation Model (GCM—ECHAM5/MPIOM1). The leading interannual and multi-decadal modes of variability of explosive cyclone track density are characterized by a strengthening/weakening pattern between Newfoundland and Iceland, which is mainly modulated by the NAO at both timescales. However, the NAO control of interannual cyclone variability is not stationary in time and abruptly fluctuates during periods of 20–25 years long both in NCEP and ECHAM5/MPIOM1. These transitions are accompanied by structural changes in the leading mode of explosive cyclone variability, and by decreased/enhanced baroclinicity over the sub-polar/sub-tropical North Atlantic. The influence of the ocean is apparently important for both the occurrence and persistence of such anomalous periods. In the GCM, the Atlantic Meridional Overturning Circulation appears to influence the large-scale baroclinicity and explosive cyclone development over the North Atlantic. These results permit a better understanding of explosive cyclogenesis variability at different climatic timescales and might help to improve predictions of these hazardous events.
Resumo:
Wireless sensor networks (WSNs) are generally used to monitor hazardous events in inaccessible areas. Thus, on one hand, it is preferable to assure the adoption of the minimum transmission power in order to extend as much as possible the WSNs lifetime. On the other hand, it is crucial to guarantee that the transmitted data is correctly received by the other nodes. Thus, trading off power optimization and reliability insurance has become one of the most important concerns when dealing with modern systems based on WSN. In this context, we present a transmission power self-optimization (TPSO) technique for WSNs. The TPSO technique consists of an algorithm able to guarantee the connectivity as well as an equally high quality of service (QoS), concentrating on the WSNs efficiency (Ef), while optimizing the transmission power necessary for data communication. Thus, the main idea behind the proposed approach is to trade off WSNs Ef against energy consumption in an environment with inherent noise. Experimental results with different types of noise and electromagnetic interference (EMI) have been explored in order to demonstrate the effectiveness of the TPSO technique.
Resumo:
Wireless mobile sensor networks are enlarging the Internet of Things (IoT) portfolio with a huge number of multimedia services for smart cities. Safety and environmental monitoring multimedia applications will be part of the Smart IoT systems, which aim to reduce emergency response time, while also predicting hazardous events. In these mobile and dynamic (possible disaster) scenarios, opportunistic routing allows routing decisions in a completely distributed manner, by using a hop- by-hop route decision based on protocol-specific characteristics, and a predefined end-to-end path is not a reliable solution. This enables the transmission of video flows of a monitored area/object with Quality of Experience (QoE) support to users, headquarters or IoT platforms. However, existing approaches rely on a single metric to make the candidate selection rule, including link quality or geographic information, which causes a high packet loss rate, and reduces the video perception from the human standpoint. This article proposes a cross-layer Link quality and Geographical-aware Opportunistic routing protocol (LinGO), which is designed for video dissemination in mobile multimedia IoT environments. LinGO improves routing decisions using multiple metrics, including link quality, geographic loca- tion, and energy. The simulation results show the benefits of LinGO compared with well-known routing solutions for video transmission with QoE support in mobile scenarios.
Resumo:
Hazard and operability (HAZOP) studies on chemical process plants are very time consuming, and often tedious, tasks. The requirement for HAZOP studies is that a team of experts systematically analyse every conceivable process deviation, identifying possible causes and any hazards that may result. The systematic nature of the task, and the fact that some team members may be unoccupied for much of the time, can lead to tedium, which in turn may lead to serious errors or omissions. An aid to HAZOP are fault trees, which present the system failure logic graphically such that the study team can readily assimilate their findings. Fault trees are also useful to the identification of design weaknesses, and may additionally be used to estimate the likelihood of hazardous events occurring. The one drawback of fault trees is that they are difficult to generate by hand. This is because of the sheer size and complexity of modern process plants. The work in this thesis proposed a computer-based method to aid the development of fault trees for chemical process plants. The aim is to produce concise, structured fault trees that are easy for analysts to understand. Standard plant input-output equation models for major process units are modified such that they include ancillary units and pipework. This results in a reduction in the nodes required to represent a plant. Control loops and protective systems are modelled as operators which act on process variables. This modelling maintains the functionality of loops, making fault tree generation easier and improving the structure of the fault trees produced. A method, called event ordering, is proposed which allows the magnitude of deviations of controlled or measured variables to be defined in terms of the control loops and protective systems with which they are associated.
Resumo:
Water systems in the Sultanate of Oman are inevitably exposed to varied threats and hazards due to both natural and man-made hazards. Natural disasters, especially tropical cyclone Gonu in 2007, cause immense damage to water supply systems in Oman. At the same time water loss from leaks is a major operational problem. This research developed an integrated approach to identify and rank the risks to the water sources, transmission pipelines and distribution networks in Oman and suggests appropriate mitigation measures. The system resilience was evaluated and an emergency response plan for the water supplies developed. The methodology involved mining the data held by the water supply utility for risk and resilience determination and operational data to support calculations of non-revenue water. Risk factors were identified, ranked and scored at a stakeholder workshop and the operational information required was principally gathered from interviews. Finally, an emergency response plan was developed by evaluating the risk and resilience factors. The risk analysis and assessment used a Coarse Risk Analysis (CRA) approach and risk scores were generated using a simple risk matrix based on WHO recommendations. The likelihoods and consequences of a wide range of hazardous events were identified through a key workshop and subsequent questionnaires. The thesis proposes a method of translating the detailed risk evaluations into resilience scores through a methodology used in transportation networks. A water audit indicated that the percentage of NRW in Oman is greater than 35% which is similar to other Gulf countries but high internationally. The principal strategy for managing NRW used in the research was the AWWA water audit method which includes free to use software and was found to be easy to apply in Oman. The research showed that risks to the main desalination processes can be controlled but the risk due to feed water quality might remain high even after implementing mitigation measures because the intake is close to an oil port with a significant risk of oil contamination and algal blooms. The most severe risks to transmission mains were found to be associated with pipe rather than pump failure. The systems in Oman were found to be moderately resilient, the resilience of desalination plants reasonably high but the transmission mains and pumping stations are very vulnerable. The integrated strategy developed in this study has a wide applicability, particularly in the Gulf area, which may have risks from exceptional events and will be experiencing NRW. Other developing countries may also experience such risks but with different magnitudes and the risk evaluation tables could provide a useful format for further work.
Resumo:
The hazards associated with major accident hazard (MAH) industries are fire, explosion and toxic gas releases. Of these, toxic gas release is the worst as it has the potential to cause extensive fatalities. Qualitative and quantitative hazard analyses are essential for the identitication and quantification of the hazards associated with chemical industries. This research work presents the results of a consequence analysis carried out to assess the damage potential of the hazardous material storages in an industrial area of central Kerala, India. A survey carried out in the major accident hazard (MAH) units in the industrial belt revealed that the major hazardous chemicals stored by the various industrial units are ammonia, chlorine, benzene, naphtha, cyclohexane, cyclohexanone and LPG. The damage potential of the above chemicals is assessed using consequence modelling. Modelling of pool fires for naphtha, cyclohexane, cyclohexanone, benzene and ammonia are carried out using TNO model. Vapor cloud explosion (VCE) modelling of LPG, cyclohexane and benzene are carried out using TNT equivalent model. Boiling liquid expanding vapor explosion (BLEVE) modelling of LPG is also carried out. Dispersion modelling of toxic chemicals like chlorine, ammonia and benzene is carried out using the ALOHA air quality model. Threat zones for different hazardous storages are estimated based on the consequence modelling. The distance covered by the threat zone was found to be maximum for chlorine release from a chlor-alkali industry located in the area. The results of consequence modelling are useful for the estimation of individual risk and societal risk in the above industrial area.Vulnerability assessment is carried out using probit functions for toxic, thermal and pressure loads. Individual and societal risks are also estimated at different locations. Mapping of threat zones due to different incident outcome cases from different MAH industries is done with the help of Are GIS.Fault Tree Analysis (FTA) is an established technique for hazard evaluation. This technique has the advantage of being both qualitative and quantitative, if the probabilities and frequencies of the basic events are known. However it is often difficult to estimate precisely the failure probability of the components due to insufficient data or vague characteristics of the basic event. It has been reported that availability of the failure probability data pertaining to local conditions is surprisingly limited in India. This thesis outlines the generation of failure probability values of the basic events that lead to the release of chlorine from the storage and filling facility of a major chlor-alkali industry located in the area using expert elicitation and proven fuzzy logic. Sensitivity analysis has been done to evaluate the percentage contribution of each basic event that could lead to chlorine release. Two dimensional fuzzy fault tree analysis (TDFFTA) has been proposed for balancing the hesitation factor invo1ved in expert elicitation .
Resumo:
The so called cascading events, which lead to high-impact low-frequency scenarios are rising concern worldwide. A chain of events result in a major industrial accident with dreadful (and often unpredicted) consequences. Cascading events can be the result of the realization of an external threat, like a terrorist attack a natural disaster or of “domino effect”. During domino events the escalation of a primary accident is driven by the propagation of the primary event to nearby units, causing an overall increment of the accident severity and an increment of the risk associated to an industrial installation. Also natural disasters, like intense flooding, hurricanes, earthquake and lightning are found capable to enhance the risk of an industrial area, triggering loss of containment of hazardous materials and in major accidents. The scientific community usually refers to those accidents as “NaTechs”: natural events triggering industrial accidents. In this document, a state of the art of available approaches to the modelling, assessment, prevention and management of domino and NaTech events is described. On the other hand, the relevant work carried out during past studies still needs to be consolidated and completed, in order to be applicable in a real industrial framework. New methodologies, developed during my research activity, aimed at the quantitative assessment of domino and NaTech accidents are presented. The tools and methods provided within this very study had the aim to assist the progress toward a consolidated and universal methodology for the assessment and prevention of cascading events, contributing to enhance safety and sustainability of the chemical and process industry.
Resumo:
The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.
Resumo:
INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.
Resumo:
The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.
Resumo:
Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.
Resumo:
Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)
Resumo:
We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use
Resumo:
Objective: To determine whether information from genetic risk variants for diabetes is associated with cardiovascular events incidence. Methods: From the about 30 known genes associated with diabetes, we genotyped single-nucleotide polymorphisms at the 10 loci most associated with type-2 diabetes in 425 subjects from the MASS-II Study, a randomized study in patients with multi-vessel coronary artery disease. The combined genetic information was evaluated by number of risk alleles for diabetes. Performance of genetic models relative to major cardiovascular events incidence was analyzed through Kaplan-Meier curve comparison and Cox Hazard Models and the discriminatory ability of models was assessed for cardiovascular events by calculating the area under the ROC curve. Results: Genetic information was able to predict 5-year incidence of major cardiovascular events and overall-mortality in non-diabetic individuals, even after adjustment for potential confounders including fasting glycemia. Non-diabetic individuals with high genetic risk had a similar incidence of events then diabetic individuals (cumulative hazard of 33.0 versus 35.1% of diabetic subjects). The addition of combined genetic information to clinical predictors significantly improved the AUC for cardiovascular events incidence (AUC = 0.641 versus 0.610). Conclusions: Combined information of genetic variants for diabetes risk is associated to major cardiovascular events incidence, including overall mortality, in non-diabetic individuals with coronary artery disease.