982 resultados para GERMINATING LEGUME SEEDS
Resumo:
Selostus: Palkoviljojen ja rypsipuristeiden koostumus, aminohappojen ohutsuolisulavuus sekä rehuarvo sikojen ruokinnassa
Resumo:
The endosperm of seeds of Sesbania virgata (Cav.) Pers. accumulates galactomannan as a cell wall storage polysaccharide. It is hydrolysed by three enzymes, one of them being alpha-galactosidase. A great amount of protein bodies is found in the cytoplasm of endospermic cells, which are thought to play the major role as a nitrogen reserve in this seed. The present work aimed at understanding how the production of enzymes that degrade storage compounds is controlled. We performed experiments with addition of inhibitors of transcription (actinomycin-d and alpha-amanitin) and translation (cycloheximide) during and after germination. In order to follow the performance of storage mobilisation, we measured fresh mass, protein contents and alpha-galactosidase activity. All the inhibitors tested had little effect on seed germination and seedling development. Actinomycin-d and cycloheximide provoked a slight inhibition of the storage protein degradation and concomitantly lead to an elevation of the alpha-galactosidase activity. Although alpha-amanitin showed some effect on seedling development at latter stages, it presented the former effect and did not change galactomannan degradation performance. Our data suggest that some of the proteases may be synthesised de novo, whereas alpha-galactosidase seems to be present in the endosperm cells probably as an inactive polypeptide in the protein bodies, being probably activated by proteolysis when the latter organelle is disassembled. These evidences suggest the existence of a connection between storage proteins and carbohydrates mobilisation in seeds of S. virgata, which would play a role by assuring a balanced afflux of the carbon and nitrogen to the seedling development.
Resumo:
BACKGROUND: Baru (Dipteryx alata Vog.) is a fruit distributed throughout the Brazilian savanna and contains a seed with a high protein content, whose properties have been rarely explored. The purpose of this study was to characterize this protein, especially by isolation and quantifying its fractions and measuring some of its molecular properties. RESULTS: Baru seeds contain 244 g kg(-1) protein on a dry weight basis. Solubility profiles showed a preponderance of globulins. This fraction dominated the seed composition, with 61.7 wt% of the total soluble proteins. Albumins and glutelins accounted for 14 and 3.3 wt%, respectively. SDS-PAGE resolution of albumin and globulin showed main bands with molecular weights of 84 kDa and 64,66 and 73 kDa, respectively. The total protein of the flour and the globulin showed values of in vitro digestibility of 85.59% and 90.54%, relative to casein. Total globulin produced only one chromatographic peak, both on Sepharose CL-6B gel filtration and on DEAE-cellulose ion-exchange columns, eluted at a concentration of 0.12 mol L(-1) NaCl. CONCLUSION: The baru seed had high protein content with large quantities of storage proteins. The chromatographic and solubility profiles indicate the predominance of a fraction with characteristics of a legumin-type protein. (C) 2011 Society of Chemical Industry
Resumo:
Glyphosate is a systemic, nonselective, postemergence herbicide that inhibits growth of both weeds and crop plants. Once inside the plant, glyphosate interferes with biosynthesis of aromatic amino acids phenylalanine, tyrosine, and tryptophan, by inhibiting the activity of 5enolpyruvylshikimate-3-phosphate synthase (EPSPS), a key enzyme of the shikimate pathway. The objective of this work was to develop a simple, effective and inexpensible method for identification of transgenic soybean tolerant to glyphosate. This technique consisted in germinating soybean seeds in filter paper moistened with 100 to 200 muM of glyphosate. Transgenic soybean seeds tolerant to glyphosate germinated normally in this solution and, between 7 and 10 days, started to develop a primary root system. However non-transgenic seeds stopped primary root growth and emission of secondary roots.
Resumo:
Re-establishing nutrient-cycling is often a key goal of mine-site restoration. This goal can be achieved by applying fertilisers (particularly P) in combination with seeding N-fixing legumes. However, the effect of this strategy on other key restoration goals such as the establishment and growth of non-leguminous species has received little attention. We investigated the effects of P-application rates either singly, or in combination with seeding seven large understorey legume species, on jarrah forest restoration after bauxite mining. Five years after P application and seeding, legume species richness, density and cover were higher in the legume-seeded treatment. However, the increased establishment of legumes did not lead to increased soil N. Increasing P-application rates from 0 to 80 kg P ha−1 did not affect legume species richness, but significantly reduced legume density and increased legume cover: cover was maximal (∼50%) where 80 kg P ha−1 had been applied with large legume seeds. Increasing P-application had no effect on species richness of non-legume species, but increased the density of weeds and native ephemerals. Cover of non-legume species decreased with increasing P-application rates and was lower in plots where large legumes had been seeded compared with non-seeded plots. There was a significant legume × P interaction on weed and ephemeral density: at 80 kg P ha−1 the decline in density of these groups was greatest where legumes were seeded. In addition, the decline in cover for non-legume species with increasing P was greatest when legumes were seeded. Applying 20 kg P ha−1 significantly increased tree growth compared with tree growth in unfertilised plots, but growth was not increased further at 80 kg ha−1 and tree growth was not affected by seeding large legumes. Taken together, these data indicate that 80 kg ha−1 P-fertiliser in combination with (seeding) large legumes maximised vegetation cover at five years but could be suboptimal for re-establishing a jarrah forest community that, like unmined forest, contains a diverse community of slow-growing re-sprouter species. The species richness and cover of non-legume understorey species, especially the resprouters, was highest in plots that received either 0 or 20 kg ha−1 P and where large legumes had not been seeded. Therefore, our findings suggest that moderation of P-fertiliser and legumes could be the best strategy to fulfil the multiple restoration goals of establishing vegetation cover, while at the same time maximising tree growth and species richness of restored forest.
Resumo:
The presence of phaseolin (a vicilin-like 7S storage globulin) peptides in the seed coat of the legume Phaseolus lunatus L. (lima bean) was demonstrated by N-terminal amino acid sequencing. Utilizing an artificial seed system assay we showed that phaseolin, isolated from both cotyledon and testa tissues of P. lunatus, is detrimental to the nonhost bruchid Callosobruchus maculatus (F) (cowpea weevil) with ED50 of 1.7 and 3.5%, respectively. The level of phaseolin in the seed coat (16.7%) was found to be sufficient to deter larval development of this bruchid. The expression of a C. maculatus-detrimental protein in the testa of nonhost seeds suggests that the protein may have played a significant role in the evolutionary adaptation of bruchids to legume seeds.
Resumo:
Chitin-binding vicilins from legume seeds (Erythrina velutina. Canavalia ensiformes and Phaseolus vulgares) were isolated by ammonium sulfate followed by affinity chromatography on a chitin column. Effect of these vicilins on female adults of Ceratitis capitata was examined by bioassay and in a semi-field assay model. Mechanism of action of the vicilins was determined by in vivo digestibility and chitin affinity. Among the tested vicilins, E. velutina when added to diet caused strong effect on mortality at 10% dose. This insecticidal property was tested in a semi-field assay which showed the same effect observed in laboratory conditions, where doses of 10% and 15% were lethal to female adults of C. capitata. These deleterious effects were not only associated to the binding to chitin structures present in peritrophic membrane, but principally to its low digestibility in the C. capitata digestive tract. This fact was confirmed because chiting binding proteins as WGA and the other tested vicilins were not toxic to female adults of C. capitata due susceptibility of these proteins to digestive enzymes of the insects. By other side EvV was more resistant to digestive enzymes, causing deleterious effects on female adults of C. capitata. These results showed that EvV may be part of the pest management programs or an alternative in plant improvement program in the population control of this fruticulture pest
Resumo:
Globulins fractions of legume seeds of Crotalaria pallida, Erytrina veluntina and Enterolobium contortisiliquum were isolated and submitted to assays against serine, cysteine and aspartic proteinases, as also amylase present in midgut of C. maculatus and Z. subfasciatus. Hemagglutination assays indicated presence of a lectin in E. veluntina globulin fractions. This lectin had affinity to human erythrocytes type A, B and O. Vicilins were purified by chromatography on Sephacryl S-300 followed of a chromatography on Sephacryl S-200, which was calibrated using protein markers. Vicilins from C. pallida (CpV) and E. veluntina (EvV) seeds had a molecular mass of 124.6 kDa and E. contortisiliquum a molecular mass of 151kDa. Eletrophoresis in presence of SDS showed that CpV was constituted by four subunities with apparent molecular mass of 66, 63, 57 and 45 kDa, EvV with three subunities with apparent molecular mass of 45kDa and EcV four subunities, two with 37.1 kDa and two with 25.8 kDa. Non denaturantig eletrophoresis displayed single bands with high homogeneity, where CpV had lower acidic behavior. All vicilins are glycoproteins with carbohydrate contents at 1 to1.5%. Bioassays were done to detect deleterious effects of vicilins against C. maculatus and Z. subfasciatus larvae. CpV, EvV and EcV exhibited a WD50 of 0.28, 0.19 and 1.03%; LD50 0.2, 0.26, and 1.11% respectively to C. maculatus. The dose responses of CpV, EvV and EcV to Z. subfasciatus were: WD50 of 0.12, 0.14, 0.65% and LD50 of 0.09, 0.1, and 0.43% respectively. The mechanism of action of these proteins to bruchids should be based on their properties of bind to chitin present in mid gut of larvae associated with the low digestibility of vicilin. In assays against phytopatogenous fungus, only EcV was capable of inhibit F. solani growth at concentrations of 10 and 20 µg and its action mechanism should be also based in the affinity of EcV to chitin present in the fungi wall
Resumo:
Grains and legume seeds are foods that form the basis of the diets of many cultures around the world, winch contritbute to the daily nutrient requirements of humans. Vicilins (7S globulin) are storage proteins found in legume seeds, and may have an additional function constitutive defense of the embryo against pests and pathogens. In this work the vicilin from Anadenanthera macrocarpa - AmV (red-angico), was purified and partially characterized, its effect on development and larval survival and adult emergence of Callosobruchus maculatus was evaluated by determination of LD50, WD50 and ED50 in system bioassay. Purification of vicilin was initiated by the chitin affinity chromatography and then gel filtration (Superdex 75 Tricorn 10x300 mm) FPLC system followed by reverse phase chromatography (C8 phenomenex) on HPLC system. Bioassays WD50 and LD50 for larvae were 0.32% and 0.33% (w:w) respectively, since the ED50 for adults was 0.096%. The probable mechanism of action was evaluated by testing digestibility of AmV in vitro, and observed for the involvement of two fragments vicilins immunoreactive against polyclonal Anti-vicilin from Erythrina velutina (Anti-EvV) about of 22 and 13 kDa chitin binding. The AmV in its native form has been recognized by the anti-EvV, indicating that there is a conserved region in the vicilin and is probably corresponding to the chitin binding domains. These results point to a new vicilin chitin binding that can subsequently be used as a possible biopesticide protein source, in order to control insect pest C. maculatus and confirm literature findings that demonstrate vicilin in the presence of different kinds of ligands to conserved regions chitin not yet characterized
Resumo:
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
Resumo:
Caesalpinia echinata and C ferrea var. ferrea have different seed behaviours and seed and fruit types. Comparison of the seed ontogeny and anatomy partly explained the differences in seed behaviour between these two species of Brazilian legumes; some differences were also related to fruit development. The seed coat in C. ferrea consisted of two layers of osteosclereids, as well as macrosclereids and fibres, to form a typical legume seed coat, whereas C. echinata had only macrosclereids and fibres. In C. echinata, the developing seed coat had paracytic stomata, a feature rarely found in legume seeds. These seed coat features may account for the low longevity of C. echinata seeds. The embryogeny was similar in both species, with no differences in the relationship between embryo growth and seed growth. The seeds of both species behaved as typical endospermic seeds, despite their different morphological classification (exendospermic orthodox seeds were described for C. echinata and endospermic orthodox seeds for C. ferrea). Embryo growth in C. ferrea accelerated when the sclerenchyma of the pericarp was developing, whereas embryonic growth in C. echinata was associated with the conclusion of spine and secretory reservoir development in the pericarp. Other features observed included an endothelial layer that secreted mucilage in both species, a nucellar summit, which grew up into the micropyle, and a placental obturator that connected the ovarian tissue to the ovule in C. ferrea. (C) 2004 the Linnean Society of London.
Resumo:
This study aimed to evaluate the effect of simulated chewing in the laboratory on the survival of seeds of four tropical forage legumes (butterfly pea, Clitorea ternatea; estilosantes, Stylosanthes capitata/S. macrocephala 'Campo Grande; archer, Macrotyloma axillare and perennial soybean, Neonotonia wightii) submitted to different periods of acid enzymatic digestion in vitro. Three trials were conducted to observe the percentage of destroyed seeds by the mastication; to compare the germination of the seeds (intact seeds, simulated mastication, scarification with sandpaper, mastication and scarification with sandpaper). And, finally the seeds were incubated at 39oC with hydrochloric acid and pepsin for: 0, 2, 4, 8, 12 and 24 hours. The percentages of not destroyed seeds in mastication (archer, 91,5; perennial soybean, 88.0; butterfly pea, 82.1, and estilo, 81.1), associated with the beneficial effects of scarification on germination (64.7, 60.0, 92.0 e 87.3%, respectively) and the effects of time of acid-enzymatic digestion (75% higher if they stay 24 hours in HCl + pepsin) associated to the hard and not permeable coats of legume seeds, allow a high potential for resistance, and to pass intact through the digestive tract of cattle, being able to germinate when defecated in the pastures. However, estilo should not be included in the feeding of cattle for this purpose, because it do not resists the acid-enzyme digestion.
Resumo:
Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)
Resumo:
A multisubunit form of acetyl coenzyme A (CoA) carboxylase (ACCase) from soybean (Glycine max) was characterized. The enzyme catalyzes the formation of malonyl CoA from acetyl CoA, a rate-limiting step in fatty acid biosynthesis. The four known components that constitute plastid ACCase are biotin carboxylase (BC), biotin carboxyl carrier protein (BCCP), and the α- and β-subunits of carboxyltransferase (α- and β-CT). At least three different cDNAs were isolated from germinating soybean seeds that encode BC, two that encode BCCP, and four that encode α-CT. Whereas BC, BCCP, and α-CT are products of nuclear genes, the DNA that encodes soybean β-CT is located in chloroplasts. Translation products from cDNAs for BC, BCCP, and α-CT were imported into isolated pea (Pisum sativum) chloroplasts and became integrated into ACCase. Edman microsequence analysis of the subunits after import permitted the identification of the amino-terminal sequence of the mature protein after removal of the transit sequences. Antibodies specific for each of the chloroplast ACCase subunits were generated against products from the cDNAs expressed in bacteria. The antibodies permitted components of ACCase to be followed during fractionation of the chloroplast stroma. Even in the presence of 0.5 m KCl, a complex that contained BC plus BCCP emerged from Sephacryl 400 with an apparent molecular mass greater than about 800 kD. A second complex, which contained α- and β-CT, was also recovered from the column, and it had an apparent molecular mass of greater than about 600 kD. By mixing the two complexes together at appropriate ratios, ACCase enzymatic activity was restored. Even higher ACCase activities were recovered by mixing complexes from pea and soybean. The results demonstrate that the active form of ACCase can be reassembled and that it could form a high-molecular-mass complex.
Resumo:
Chitin-binding vicilins from legume seeds (Erythrina velutina. Canavalia ensiformes and Phaseolus vulgares) were isolated by ammonium sulfate followed by affinity chromatography on a chitin column. Effect of these vicilins on female adults of Ceratitis capitata was examined by bioassay and in a semi-field assay model. Mechanism of action of the vicilins was determined by in vivo digestibility and chitin affinity. Among the tested vicilins, E. velutina when added to diet caused strong effect on mortality at 10% dose. This insecticidal property was tested in a semi-field assay which showed the same effect observed in laboratory conditions, where doses of 10% and 15% were lethal to female adults of C. capitata. These deleterious effects were not only associated to the binding to chitin structures present in peritrophic membrane, but principally to its low digestibility in the C. capitata digestive tract. This fact was confirmed because chiting binding proteins as WGA and the other tested vicilins were not toxic to female adults of C. capitata due susceptibility of these proteins to digestive enzymes of the insects. By other side EvV was more resistant to digestive enzymes, causing deleterious effects on female adults of C. capitata. These results showed that EvV may be part of the pest management programs or an alternative in plant improvement program in the population control of this fruticulture pest