862 resultados para Futures Stages


Relevância:

60.00% 60.00%

Publicador:

Resumo:

El presente trabajo titulado “Construcción de una visión compartida, a través de una Metodología Prospectiva que contribuya al Direccionamiento Estratégico de la Empresa C.I. CUPISA S.A.”, busca desarrollar un ejercicio para la construcción de un análisis estructural dentro de una visión compartida, con base en la metodología prospectiva, la cual contribuye a la identificación de los objetivos estratégicos y de los escenarios futuros de C.I. CUPISA S.A.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

The Clean Development Mechanism (CDM) has successfully demonstrated that market-based mechanisms can achieve some cost effective emissions reductions in developing countries. However the distribution of CDM projects has been extremely uneven across countries and regions, and a few technologies and sectors have dominated the early stages of CDM experience. This has caused some to question whether the CDM has fallen short of its potential in contributing to sustainable development. We review the broad patterns of CDM project approvals and evaluate 10 CDM projects according to their sustainability benefits. The difficulty of defining “sustainable development” and the process of defining criteria by individual non-Annex 1 governments has meant that sustainable development concerns have been marginalized in some countries. Given these observed limitations, we present possible CDM policy futures, focusing on the main proposals for a post-2012 climate regime. Five options for enhancing the sustainable development benefits in the CDM are discussed, including proactive approaches to favour eligibility of emission reduction projects which ensure such co-benefits.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

For the treatment and monitoring of Parkinson's disease (PD) to be scientific, a key requirement is that measurement of disease stages and severity is quantitative, reliable, and repeatable. The last 50 years in PD research have been dominated by qualitative, subjective ratings obtained by human interpretation of the presentation of disease signs and symptoms at clinical visits. More recently, “wearable,” sensor-based, quantitative, objective, and easy-to-use systems for quantifying PD signs for large numbers of participants over extended durations have been developed. This technology has the potential to significantly improve both clinical diagnosis and management in PD and the conduct of clinical studies. However, the large-scale, high-dimensional character of the data captured by these wearable sensors requires sophisticated signal processing and machine-learning algorithms to transform it into scientifically and clinically meaningful information. Such algorithms that “learn” from data have shown remarkable success in making accurate predictions for complex problems in which human skill has been required to date, but they are challenging to evaluate and apply without a basic understanding of the underlying logic on which they are based. This article contains a nontechnical tutorial review of relevant machine-learning algorithms, also describing their limitations and how these can be overcome. It discusses implications of this technology and a practical road map for realizing the full potential of this technology in PD research and practice. © 2016 International Parkinson and Movement Disorder Society.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Egg and pupa of Lobeza dentilinea Schaus, 1901 are described and illustrated for the first time. Eggs are smooth, dome-shaped, and greenish at oviposition. Last instar larvae have an aposematic coloration and the chaetotaxy is very similar to other notodontines, except for the number of lateral setae: L. dentilinea has three instead of four lateral setae on abdominal segments A3-A6. Pupae are light brown and typical of the family, with the last abdominal segments broadly round. Evidence from the adult morphology supporting the placement of the genus in Notodontinae includes proboscis smaller than the length of the head, epiphysis with more than half the length of tibia, tarsal claws simple, and labial palpi short. Male and female are confidently associated, and a redescription of the species is presented based on both sexes. Larvae of L. dentilinea are here recorded feeding on a Melastomataceae.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The development of new drugs is one strategy for malaria control. Biochemical pathways localised in the apicoplast of the parasite, such as the synthesis of isoprenic precursors, are excellent targets because they are different or absent in the human host. Isoprenoids are a large and highly diverse group of natural products with many functions and their synthesis is essential for the parasite's survival. During the last few years, the genes, enzymes, intermediates and mechanisms of this biosynthetic route have been elucidated. In this review, we comment on some aspects of the methylerythritol phosphate pathway and discuss the presence of diverse isoprenic products such as dolichol, ubiquinone, carotenoids, menaquinone and isoprenylated proteins, which are biosynthesised during the intraerythrocytic stages of Plasmodium falciparum.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Stages of change assess individual motivation for lifestyle changes, contributing to the development of more effective intervention strategies. The objective of the present study was to identify factors associated with stages of change for lower intake of red meat and higher intake of vegetables in a cross-sectional analysis of 578 Japanese-Brazilians aged 30-90 years. In adjusted logistic regression models, the odds ratios for women (OR = 1.89; 95%CI: 1.154; 3.103) and physically active individuals (OR = 1.00; 95%CI: 1.000; 1.001) were positively associated with stage of "action" for the higher intake of vegetables. Inverse associations were observed between central obesity (OR = 0.5; 95%CI: 0.351; 0.887) and highest tertile of red meat intake (OR = 0.50; 95%CI: 0.302; 0.817), as well as a positive association between age (OR = 1.04; 95%CI: 1.020; 1.070) and the stage of "action" to the lower intake of meat were verified. Motivation for Japanese-Brazilians to change their food intake was linked to lifestyle. Stage of change is an important factor in mediating food intake behavior change.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We present K-band spectra of the near infrared counterparts to IRS 2E and IRS 2W which is associated with the ultracompact H II region W51d, both of them embedded sources in the Galactic compact H II region W51 IRS 2. The high spatial resolution observations were obtained with the laser guide star facility and Near-infrared Integral Field Spectrograph (NIFS) mounted at the Gemini-North observatory. The spectrum of the ionizing source of W51d shows the photospheric features N III ( 21155 angstrom) in emission and He II ( 21897 angstrom) in absorption which lead us to classify it as a young O3 type star. We detected CO overtone in emission at 23000 angstrom in the spectrum of IRS 2E, suggesting that it is a massive young object still surrounded by an accretion disk, probably transitioning from the hot core phase to an ultracompact H II region.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Context. Compact groups of galaxies are entities that have high densities of galaxies and serve as laboratories to study galaxy interactions, intergalactic star formation and galaxy evolution. Aims. The main goal of this study is to search for young objects in the intragroup medium of seven compact groups of galaxies: HCG 2, 7, 22, 23, 92, 100 and NGC 92 as well as to evaluate the stage of interaction of each group. Methods. We used Fabry-Perot velocity fields and rotation curves together with GALEX NUV and FUV images and optical R-band and HI maps. Results. (i) HCG 7 and HCG 23 are in early stages of interaction; (ii) HCG 2 and HCG 22 are mildly interacting; and (iii) HCG 92, HCG 100 and NGC 92 are in late stages of evolution. We find that all three evolved groups contain populations of young blue objects in the intragroup medium, consistent with ages < 100 Myr, of which several are younger than < 10 Myr. We also report the discovery of a tidal dwarf galaxy candidate in the tail of NGC 92. These three groups, besides containing galaxies that have peculiar velocity fields, also show extended HI tails. Conclusions. Our results indicate that the advanced stage of evolution of a group, together with the presence of intragroup HI clouds, may lead to star formation in the intragroup medium. A table containing all intergalactic HII regions and tidal dwarf galaxies confirmed to date is appended.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

This study describes the effects of different intensities of UVB radiation on growth and morphology of early development stages of Iridaea cordata in germlings, young gametophytes originated in the laboratory and young fronds collected in the Magellan Strait, Chile. The experiments were carried out during four weeks in controlled conditions of temperature and photoperiod and the results were compared with a control treatment (without UVB). All UVB irradiation treatments caused bleaching and decrease in growth rates of germlings. Additionally, initial upright fronds were not observed in any of the UVB treatments, where as those cultivated in UVB absence developed erect ones in the second week of culture. The young gametophytes exhibited morphological alteration (small number and size of basal ramifications, curling of tips, bleaching and necrosis) and decrease in growth when exposed to UVB radiation. Young fronds collected from the field showed mainly morphological alterations (curling of frond). Morphological alterations in young gametophytes and young fronds of I. cordata could be interpreted as a defense against UVB by reducing the area exposed to radiation. However, high level of UVB radiation can produce irreparable damage, such as necrosis, observed in young gametophytes originated in the laboratory. Finally, the UVB effects on early developmental stages of I. cordata depend on the UVB irradiance and time of exposition.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Wild-caught larvae, attributed to the lobster shrimp Arius serratus, consisting of two zoeal stages and a decapodid (megalopa), are described in detail. Parentage of larvae was ascertained based on geographic distribution of axiideans and gebiideans (= former thalassinideans) within the study area and close morphological resemblance to other congeneric larval stages. Larvae of A. serratus represent the first described 'thalassinidean' larvae from Canadian Atlantic waters and the first for Axiidae within the northwest Atlantic. Among axiidean larvae, those of A. serratus most closely resemble larvae of A. stirhynchus from the eastern Atlantic. Distinct features include the spination of the pleon that set A. serratus zoeae apart from those of most other 'thalassinideans' but that, in combination with a telson very similar to Homarus americanus, contributes to the general resemblance of A. serratus larvae to those of the American lobster. The primary distinction between these taxa is the presence of a chela on the third pereiopod in the latter that is not present in the former. In view of these appendages being prone to loss or damage, other characters that separate these taxa are listed and discussed. Given the uncertain status of some taxa within Axiidae and limited detailed information of larvae with certain parentage, difficulties in delineating the family based on larvae persist, as they do for cladistic analyses using adult morphology and molecular approaches.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The Brazilian Amazon is one of the most rapidly developing agricultural areas in the world and represents a potentially large future source of greenhouse gases from land clearing and subsequent agricultural management. In an integrated approach, we estimate the greenhouse gas dynamics of natural ecosystems and agricultural ecosystems after clearing in the context of a future climate. We examine scenarios of deforestation and postclearing land use to estimate the future (2006-2050) impacts on carbon dioxide (CO(2)), methane (CH(4)), and nitrous oxide (N(2)O) emissions from the agricultural frontier state of Mato Grosso, using a process-based biogeochemistry model, the Terrestrial Ecosystems Model (TEM). We estimate a net emission of greenhouse gases from Mato Grosso, ranging from 2.8 to 15.9 Pg CO(2)-equivalents (CO(2)-e) from 2006 to 2050. Deforestation is the largest source of greenhouse gas emissions over this period, but land uses following clearing account for a substantial portion (24-49%) of the net greenhouse gas budget. Due to land-cover and land-use change, there is a small foregone carbon sequestration of 0.2-0.4 Pg CO(2)-e by natural forests and cerrado between 2006 and 2050. Both deforestation and future land-use management play important roles in the net greenhouse gas emissions of this frontier, suggesting that both should be considered in emissions policies. We find that avoided deforestation remains the best strategy for minimizing future greenhouse gas emissions from Mato Grosso.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Studies concerning the accumulating capacity of native epiphytic bromeliads are of utmost relevance, due to the continuous incorporation of chemical elements provided by these organisms in the ecosystems. Bromeliad species from diverse So Paulo State conservation units, Brazil, were sampled for young, mature and old leaves using a sustainable sampling method. By applying INAA, the accumulation of ten chemical elements, i.e. Br, Ca, Co, Fe, K, Na, Rb, Sc, Sr and Zn, was investigated in different leaf vegetative stages. The bromeliads showed divergent chemical element distribution patterns, demonstrating a real complexity in the accumulation and translocation mechanisms utilized by these plants.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The purpose of this research is to analyze the contribution of human resources management throughout the evolutionary stages of environmental management in Brazilian companies. A theoretical framework concerning environmental management and its evolution and the `greening` of the functional and competitive dimensions of human resource management were developed. A methodological triangulation was developed in two complimentary phases. In the first phase, data were collected from 94 Brazilian companies with ISO 14001 certification. The data collected were analyzed and processed using statistical techniques. The conclusions of the first phase supported the second phase of this empirical research. The second phase consisted of a study of multiple cases in four Brazilian companies. The results show evidence of the first known empirical study of contributions of human resource dimensions throughout the stages of environmental management in Brazilian manufacturing companies.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A high nitrogen austenitic stainless steel (0.9wt% N) and an ordinary 304 austenitic stainless steel were submitted to cavitation-erosion tests in a vibratory apparatus operating at a frequency of 20 kHz. The high nitrogen stainless steel was obtained by high temperature gas nitriding a 1-mm thick strip of an UNS 31803 duplex stainless steel. The 304 austenitic stainless steel was used for comparison purposes. The specimens were characterized by scanning electron microscopy and Electron Back Scatter Diffraction. The surface of the cavitation damaged specimens was analyzed trying to find out the regions where cavitation damage occurred preferentially. The distribution of sites where cavitation inception occurred was extremely heterogeneous, concentrating basically at (i) slip lines inside some grains and (ii) Sigma-3 coincidence site lattice (CSL) boundaries (twin boundaries). Furthermore, it was observed that the CE damage spread faster inside those grains which were more susceptible to damage incubation. The damage heterogeneity was addressed to plasticity anisotropy. Grains in which the crystallographic orientation leads to high resolved shear stress show intense damage at slip lines. Grain boundaries between grains with large differences in resolved shear stress where also intensely damaged. The relationship between crystallite orientation distributions, plasticity anisotropy and CE damage mechanisms are discussed. (C) 2009 Elsevier B.V. All rights reserved.