Growth and maturation of pequi fruit of the Brazilian cerrado

The objective of this study was to characterize the development of pequi fruit (Caryocar brasiliense) of the Brazilian cerrado. It takes 84 days (12 weeks) for pequi to develop with the onset of flowering in September and early fruit set in January. Pequi fruit showed a simple sigmoid growth curve, and its growth was characterized based on fresh mass and longitudinal and transverse diameters. The contents of titratable acidity, soluble solids, β-carotene, and vitamin C increased during fruit growth, reaching their maximum values at the 12th week (84 days) after anthesis. Pequi is a fruit with an extremely high respiratory activity; its respiratory rate decreased during its development. Pequi fruit has been classified as a non-climacteric fruit due to the decrease of both respiration and ethylene production rates during maturation and ripening.

Fruit of the jambolan tree (Eugenia jambolana Lam.) and experimental diabetes

The fruit of Indian Eugenia jambolana have been shown to have therapeutic properties, but because the therapeutic potential of a plant is related to the geographic region in which the plant was grown and to the part of the plant used, we investigated Brazilian Eugenia jambolana fruit using the same preparation and experimental methods as have been used in India. The well-established metabolic cage model was used to evaluate the physiological and metabolic parameters associated with streptozotocin-induced diabetes in rats (n = 10) which had been administered, by gavage, 50 mg per day of lyophilised Eugenia jambolana fruit-pulp extract for 41 days. We found that, compared to untreated controls, rats treated with the lyophilised fruit-pulp showed no observable difference in body weight, food or water intake, urine volume, glycaemia, urinary urea and glucose, hepatic glycogen, or on serum levels of total cholesterol, HDL cholesterol or triglycerides. No change was observed in the masses of epididymal or retroperitoneal adipose tissue or of soleus or extensor digitorum longus muscles. This lack of any apparent effect on the diabetes may be attributable to the regional ecosystem where the fruit was collected and/or to the severity of the induced diabetes. (C) 2004 Elsevier B.V.. All rights reserved.

The fruit of the Spirit. Being ten addresses bearing on the spiritual life.

Mode of access: Internet.

The fruit of the spirit : or, the Christian graces /

Mode of access: Internet.

Fruit of the spirit.

Mode of access: Internet.

La bodega (The fruit of the vine) a novel,

Mode of access: Internet.

The home of the lemon

Mode of access: Internet.

Acceleration of the decomposition of Sicilian lemon leaves as an auxiliary measure in the control of citrus black spot

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Anatomical development of the pericarp and seed of Oncidium flexuosum Sims (ORCHIDACEAE)

Interpretation of the anatomical structure of the ovary and fruit of the Orchidaceae family is still controversial, which makes it difficult to understand the development and dehiscence of the fruit. The genus Oncidium is polyphyletic and is currently the subject of taxonomic studies. In this study, we have investigated the anatomical development of the pericarp and seed of Oncidium flexuosum Sims to determine important diagnostic characters that, along with molecular data, can assist in defining this group. We have found a new anatomical characteristic of the family: the presence of precursor cells for fruit dehiscence, which were visible from the beginning of development and located on the outer walls of the sterile valves. In contrast with what has been observed by different authors with other species, in the mature fruit of O. flexuosum, only the endocarp of the fertile valves and a few cells near the exocarp and the vascular bundle in the sterile valves show parietal thickening, while the rest remains parenchymatous. During the development of the ovule and embryo, we have shown that the embryonic sac of this species has eight nuclei and that the embryo has a long and elaborate suspensor. (C) 2011 Elsevier GmbH. All rights reserved.

Bioactive substance contents and antioxidant capacity of the lipid fraction of Annona crassiflora Mart. seeds

Annona crassiflora Mart. is a typical fruit of the Brazilian cerrado, considered to be a species of economic interest, mainly for its use in cooking, which is widespread among the inhabitants of that region, and can be found in many typical local dishes, especially sweets, jellies, liqueurs, soft drinks, ice creams and juices. Thus, the objective of this study was to determine the bioactive substance contents and the antioxidant capacity of the lipid fraction of A. crassiflora Mart. seeds in the interest of better identifying the quality of this raw material from the Brazilian cerrado. After the receipt of the fruits, the seeds were removed manually and, then, the lipid fraction was obtained by cold extraction with chloroform:methanol:water (2:1:0.8, v/v/v) and analyzed for the composition of phytosterols, tocopherols, fatty acids, total carotenoids, antioxidant activity and oxidative stability index. The lipid fraction showed significant quantity of bioactive substances, especially phytosterols, tocopherols and unsaturated fatty acids, as well as significant antioxidant capacity and oxidative stability, influenced by the content of phytosterols and the composition of fatty acids present in the analyzed fraction. © 2012 Elsevier B.V.

Decorative tiles between Brazil and Europe: the case of the Santa Catharina factory

Abstract It was in the first decade of the twentieth century that the first white china Factory was implemented in Brazil. Fruit of the association between the Sao Paulo Aristocracy and the Italian Romeo Ranzini, this factory was responsible for producing significant amounts of crockery in industrial moulds in sao Paulo, Brazil. It was also the first factory to produce decorative tiles that would be part of the architecture of the public buildings built between 1919 and 1922 in Commemoration of the Centennial of the Brazilian Independence. Known as The Santa Catharina Factory, this factory was inaugurated in 1913 with the participation of Italian immigrants and German technologies for the development of its first manufacturing activities. As a result of a number of economic, political and social matters that started in the previous century in the city of Sao Paulo, The Santa Catharina factory played an important role in industrial development as regards the production of national white china and was used as a model for the construction of new ceramic factories in Sao Paulo. After acquired by Matarazzo industries in 1927, had closed their activities in 1937. This research is based on the identification and analysis of the first tiles produced in Brazil by the Santa Catharina Factory, which were part of the architectural decorations of the buildings built in Sao Paulo to the celebration of the Centennial of the Brazilian Independence. Designed by Victor Dubugras, The Largo da Memoria (located in the city of Sao Paulo) and the buildings located in the "Paths of the Sea" road marked the beginning of Brazilian industrialization and the emergence of Neocolonial Movement in architecture of Sao Paulo. Studies of the first national patterns of decorative tiles approach a subject poorly researched by experts in tiled studies in Brazil, although in this case these tiles have represented not only an important milestone in the national industrialization, but also have demarcated the significant changes in architectural and decorative practices in the country in the early twentieth century; RESUMÈ: C'est durant la premiere decennie du XXe siecle que la premiere usine de porcelaine blanche fut implant& au Bresil. Elle fut le fruit de l'association entre l'aristocratie de Sao Paulo et l'italien Romeo Ranzini. L'usine produisait une quantite signifiante de porcelaine sur le territoire industriel de Sao Paulo. Ce fut egalement la premiere usine a produire des carreaux decoratifs qui sont aujourd'hui visibles dans l'architecture des batiments publics construit entre 1919 et 1922, pour la commemoration du centenaire de l'independance bresilienne. Connue sous le nom de Santa Catharina, cette usine fut inaugure en 1912. Elle fut construite par des émigrés Italiens, et utilisa pour la technologie allemande pour so production. En tant que resultat d'un certain nombre de questions economiques, politiques et sociales qui ont &butes durant le siecle precedent dans la ville de Sao Paulo, l'usine Santa Catharina a joue un role important dans le developpement industriel de la production de porcelaine blanche nationale et a ete utilise comme modele pour la construction de nouvelles usines de ceramique a Sao Paulo. Apres avoir ete achete par l'industrie Matarazzo en 1927, elle cessa ses activites en 1937. Cette recherche est basee sur l'identification et l'analyse des premiers carreaux decoratifs fabriques au Bresil par l'usine Santa Catharina, qui etait une partie des decorations architecturales des batiments construits a Sao Paulo pour la celebration du centenaire de l'Independance Bresilienne. Connue par Victor Dubugras, le "Largo da Memoria" (situe dans la ville de Sao Paulo), et les batiments situes sur le "Path of the Sea", ont marque le debut de l'industrialisation bresilienne et l'emergence d'un mouvement neocolonialiste dans l'architecture de Sao Paolo. L'etude des premiers modeles nationaux de carreaux decoratifs est un sujet peut etudie par les experts bresiliens, bien qu'ils furent un jalon importante pour l'industrialisation nationale. Its ont egalement entrains des changements importants dans les pratiques architecturales, et decoratives au sein du pays au XXe siecle. Mots-cles: Ceramique - carreaux decoratifs — L'usine Santa Catharina, Bresil - Production de carreaux; RIASSUNTO: Nel primo decennio del Novecento vide luce la prima fabbrica di ceramica di porcellana in Brasile. Frutto dell'associazione tra l'aristocrazia Paulista e l'italiano Romeo Ranzini, questa fabbrica fu responsabile della produzione di notevoli quantita di ceramica di porcellana mediante stampi industriali nella citta di San Paolo, Brasile. Fu anche la prima fabbrica a produrre azulejos che avrebbero poi fatto parte dell'architettura degli edifici pubblici costruiti tra it 1919 ed it 1922, per la commemorazione del Centenario dell'indipendenza Brasiliana. Conosciuta come Fabbrica di Santa Catharina, questa fu inaugurata nel 1913, con la partecipazione di immigrati italiani e con l'impiego di tecnologie tedesche per lo sviluppo delle sue prime attivita produttive. Risultato di una serie di cambiamenti economici, politici e sociali, che ebbero inizio nel secolo precedente nella citta di San Paolo, la Fabbrica di Santa Catharina svolse un ruolo importante nello sviluppo industriale per quanto riguarda la produzione di ceramica di porcellana nazionale e fu adottata come modello per la costruzione di nuove fabbriche a San Paolo. Successivamente, fu acquisita dalle industrie Matarazzo nel 1927, vedendo poi chiudersi le sue attivita nel 1937. Questa ricerca si basa sull'identificazione e l'analisi dei primi azulejos prodotti in Brasile dalla Fabbrica di Santa Catharina che fecero parte delle decorazioni architettoniche degli edifici costruiti a San Paolo per la commemorazione del Centenario dell'indipendenza Brasiliana. Progettati da Victor Dubugras, it Largo da Mem(Via (situato nella citta di San Paolo) e gli edifici che si trovano nei Caminhos do Mar marcarono l'inizio dell'industrializzazione brasiliana e la nascita del Movimento Neocolonial dell'architettura Paulista. Gli studi dei primi modelli di azulejos nazionali affrontano un argomento poco studiato dagli esperti in azulejaria in Brasile, nonostante rappresentino un importante avvenimento dell'industrializzazione nazionale, ma segnano anche i cambiamenti di significative pratiche architettoniche e decorative nel Paese nel primo Novecento. Parole chiave: Ceramica - porcellana - La fabbrica di Santa Catharina - Produzione di ceramica .

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Assessment of the potential genotoxic risk of medicinal Tamarindus indica fruit pulp extract using in vivo assays

Tamarindus indica has been used in folk medicine as an antidiabetic, a digestive aid, and a carminative, among other uses. Currently, there is no information in the toxicology literature concerning the safety of T. indica extract. We evaluated the clastogenic and/or genotoxic potential of fruit pulp extract of this plant in vivo in peripheral blood and liver cells of Wistar rats, using the comet assay, and in bone marrow cells of Swiss mice, using the micronucleus test. The extract was administered by gavage at doses of 1000, 1500 and 2000 mg/kg body weight. Peripheral blood and liver cells from Wistar rats were collected 24 h after treatment, for the comet assay. The micronucleus test was carried out in bone marrow cells from Swiss mice collected 24 h after treatment. The extract made with T. indica was devoid of clastogenic and genotoxic activities in the cells of the rodents, when administered orally at these three acute doses.

Fruit flies (Diptera, Tephritidae) and their associations with native host plants in a remnant area of the highly endangered Atlantic Rain Forest in the State of Espirito Santo, Brazil

The results presented in this paper refer to a host survey, lasting approximately three and a half years (February 2003-july 2006), undertaken in the Vale do Rio Doce Natural Reserve, a remnant area of the highly endangered Atlantic Rain Forest located in Linhares County, State of Espirito Santo, Brazil. A total of 330 fruit samples were collected from native plants, representing 248 species and 51 plant families. Myrtaceae was the most diverse family with 54 sampled species. Twenty-eight plant species, from ten families, are hosts of ten Anastrepha species and of Ceratitis capitata (Wiedemann). Among 33 associations between host plants and fruit flies, 20 constitute new records, including the records of host plants for A. fumipennis Lima and A. nascimentoi Zucchi. The findings were discussed in the light of their implications for rain forest conservation efforts and the study of evolutionary relationships between fruit flies and their hosts.