1000 resultados para Extrema detection


Relevância:

60.00% 60.00%

Publicador:

Resumo:

Mechanical Systems and Signal Processing, Vol.22, Number 6

Relevância:

30.00% 30.00%

Publicador:

Resumo:

En muchas áreas de la ingeniería, la integridad y confiabilidad de las estructuras son aspectos de extrema importancia. Estos son controlados mediante el adecuado conocimiento de danos existentes. Típicamente, alcanzar el nivel de conocimiento necesario que permita caracterizar la integridad estructural implica el uso de técnicas de ensayos no destructivos. Estas técnicas son a menudo costosas y consumen mucho tiempo. En la actualidad, muchas industrias buscan incrementar la confiabilidad de las estructuras que emplean. Mediante el uso de técnicas de última tecnología es posible monitorizar las estructuras y en algunos casos, es factible detectar daños incipientes que pueden desencadenar en fallos catastróficos. Desafortunadamente, a medida que la complejidad de las estructuras, los componentes y sistemas incrementa, el riesgo de la aparición de daños y fallas también incrementa. Al mismo tiempo, la detección de dichas fallas y defectos se torna más compleja. En años recientes, la industria aeroespacial ha realizado grandes esfuerzos para integrar los sensores dentro de las estructuras, además de desarrollar algoritmos que permitan determinar la integridad estructural en tiempo real. Esta filosofía ha sido llamada “Structural Health Monitoring” (o “Monitorización de Salud Estructural” en español) y este tipo de estructuras han recibido el nombre de “Smart Structures” (o “Estructuras Inteligentes” en español). Este nuevo tipo de estructuras integran materiales, sensores, actuadores y algoritmos para detectar, cuantificar y localizar daños dentro de ellas mismas. Una novedosa metodología para detección de daños en estructuras se propone en este trabajo. La metodología está basada en mediciones de deformación y consiste en desarrollar técnicas de reconocimiento de patrones en el campo de deformaciones. Estas últimas, basadas en PCA (Análisis de Componentes Principales) y otras técnicas de reducción dimensional. Se propone el uso de Redes de difracción de Bragg y medidas distribuidas como sensores de deformación. La metodología se validó mediante pruebas a escala de laboratorio y pruebas a escala real con estructuras complejas. Los efectos de las condiciones de carga variables fueron estudiados y diversos experimentos fueron realizados para condiciones de carga estáticas y dinámicas, demostrando que la metodología es robusta ante condiciones de carga desconocidas. ABSTRACT In many engineering fields, the integrity and reliability of the structures are extremely important aspects. They are controlled by the adequate knowledge of existing damages. Typically, achieving the level of knowledge necessary to characterize the structural integrity involves the usage of nondestructive testing techniques. These are often expensive and time consuming. Nowadays, many industries look to increase the reliability of the structures used. By using leading edge techniques it is possible to monitoring these structures and in some cases, detect incipient damage that could trigger catastrophic failures. Unfortunately, as the complexity of the structures, components and systems increases, the risk of damages and failures also increases. At the same time, the detection of such failures and defects becomes more difficult. In recent years, the aerospace industry has done great efforts to integrate the sensors within the structures and, to develop algorithms for determining the structural integrity in real time. The ‘philosophy’ has being called “Structural Health Monitoring” and these structures have been called “smart structures”. These new types of structures integrate materials, sensors, actuators and algorithms to detect, quantify and locate damage within itself. A novel methodology for damage detection in structures is proposed. The methodology is based on strain measurements and consists in the development of strain field pattern recognition techniques. The aforementioned are based on PCA (Principal Component Analysis) and other dimensional reduction techniques. The use of fiber Bragg gratings and distributed sensing as strain sensors is proposed. The methodology have been validated by using laboratory scale tests and real scale tests with complex structures. The effects of the variable load conditions were studied and several experiments were performed for static and dynamic load conditions, demonstrating that the methodology is robust under unknown load conditions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To assess binocular detection grating acuity using the LEA GRATINGS test to establish age-related norms in healthy infants during their first 3 months of life. In this prospective, longitudinal study of healthy infants with clear red reflex at birth, responses to gratings were measured at 1, 2, and 3 months of age using LEA gratings at a distance of 28 cm. The results were recorded as detection grating acuity values, which were arranged in frequency tables and converted to a one-octave scale for statistical analysis. For the repeated measurements, analysis of variance (ANOVA) was used to compare the detection grating acuity results between ages. A total of 133 infants were included. The binocular responses to gratings showed development toward higher mean values and spatial frequencies, ranging from 0.55 ± 0.70 cycles per degree (cpd), or 1.74 ± 0.21 logMAR, in month 1 to 3.11 ± 0.54 cpd, or 0.98 ± 0.16 logMAR, in month 3. Repeated ANOVA indicated differences among grating acuity values in the three age groups. The LEA GRATINGS test allowed assessment of detection grating acuity and its development in a cohort of healthy infants during their first 3 months of life.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A novel capillary electrophoresis method using capacitively coupled contactless conductivity detection is proposed for the determination of the biocide tetrakis(hydroxymethyl)phosphonium sulfate. The feasibility of the electrophoretic separation of this biocide was attributed to the formation of an anionic complex between the biocide and borate ions in the background electrolyte. Evidence of this complex formation was provided by (11) B NMR spectroscopy. A linear relationship (R(2) = 0.9990) between the peak area of the complex and the biocide concentration (50-900 μmol/L) was found. The limit of detection and limit of quantification were 15.0 and 50.1 μmol/L, respectively. The proposed method was applied to the determination of tetrakis(hydroxymethyl)phosphonium sulfate in commercial formulations, and the results were in good agreement with those obtained by the standard iodometric titration method. The method was also evaluated for the analysis of tap water and cooling water samples treated with the biocide. The results of the recovery tests at three concentration levels (300, 400, and 600 μmol/L) varied from 75 to 99%, with a relative standard deviation no higher than 9%.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Infections of the central nervous systems (CNS) present a diagnostic problem for which an accurate laboratory diagnosis is essential. Invasive practices, such as cerebral biopsy, have been replaced by obtaining a polymerase chain reaction (PCR) diagnosis using cerebral spinal fluid (CSF) as a reference method. Tests on DNA extracted from plasma are noninvasive, thus avoiding all of the collateral effects and patient risks associated with CSF collection. This study aimed to determine whether plasma can replace CSF in nested PCR analysis for the detection of CNS human herpesvirus (HHV) diseases by analysing the proportion of patients whose CSF nested PCR results were positive for CNS HHV who also had the same organism identified by plasma nested PCR. In this study, CSF DNA was used as the gold standard, and nested PCR was performed on both types of samples. Fifty-two patients with symptoms of nervous system infection were submitted to CSF and blood collection. For the eight HHV, one positive DNA result-in plasma and/or CSF nested PCR-was considered an active HHV infection, whereas the occurrence of two or more HHVs in the same sample was considered a coinfection. HHV infections were positively detected in 27/52 (51.9%) of the CSF and in 32/52 (61.5%) of the plasma, difference not significant, thus nested PCR can be performed on plasma instead of CSF. In conclusion, this findings suggest that plasma as a useful material for the diagnosis of cases where there is any difficulty to perform a CSF puncture.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The aim of this study was to develop a methodology using Raman hyperspectral imaging and chemometric methods for identification of pre- and post-blast explosive residues on banknote surfaces. The explosives studied were of military, commercial and propellant uses. After the acquisition of the hyperspectral imaging, independent component analysis (ICA) was applied to extract the pure spectra and the distribution of the corresponding image constituents. The performance of the methodology was evaluated by the explained variance and the lack of fit of the models, by comparing the ICA recovered spectra with the reference spectra using correlation coefficients and by the presence of rotational ambiguity in the ICA solutions. The methodology was applied to forensic samples to solve an automated teller machine explosion case. Independent component analysis proved to be a suitable method of resolving curves, achieving equivalent performance with the multivariate curve resolution with alternating least squares (MCR-ALS) method. At low concentrations, MCR-ALS presents some limitations, as it did not provide the correct solution. The detection limit of the methodology presented in this study was 50μgcm(-2).

Relevância:

20.00% 20.00%

Publicador:

Resumo:

A rapid and low cost method to determine Cr(VI) in soils based upon alkaline metal extraction at room temperature is proposed as a semi-quantitative procedure to be performed in the field. A color comparison with standards with contents of Cr(VI) in the range of 10 to 150 mg kg-1 was used throughout. For the different types of soils studied, more than 75% of the fortified soluble Cr(VI) were recovered for all levels of spike tested for both the proposed and standard methods. Recoveries of 83 and 99% were obtained for the proposed and the standard methods, respectively, taking into account the analysis of a heavily contaminated soil sample.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Previous studies indicated that patients with atherosclerosis are predominantly infected by human cytomegalovirus (HCMV), but rarely infected by type 1 Epstein-Barr virus (EBV-1). In this study, atheromas of 30 patients who underwent aortocoronary bypass surgery with coronary endartherectomy were tested for the presence of these two viruses. HCMV occurred in 93.3% of the samples and EBV-1 was present in 50% of them. Concurrent presence of both pathogens was detected in 43.3% of the samples.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Secondary caries has been reported as the main reason for restoration replacement. The aim of this in vitro study was to evaluate the performance of different methods - visual inspection, laser fluorescence (DIAGNOdent), radiography and tactile examination - for secondary caries detection in primary molars restored with amalgam. Fifty-four primary molars were photographed and 73 suspect sites adjacent to amalgam restorations were selected. Two examiners evaluated independently these sites using all methods. Agreement between examiners was assessed by the Kappa test. To validate the methods, a caries-detector dye was used after restoration removal. The best cut-off points for the sample were found by a Receiver Operator Characteristic (ROC) analysis, and the area under the ROC curve (Az), and the sensitivity, specificity and accuracy of the methods were calculated for enamel (D2) and dentine (D3) thresholds. These parameters were found for each method and then compared by the McNemar test. The tactile examination and visual inspection presented the highest inter-examiner agreement for the D2 and D3 thresholds, respectively. The visual inspection also showed better performance than the other methods for both thresholds (Az = 0.861 and Az = 0.841, respectively). In conclusion, the visual inspection presented the best performance for detecting enamel and dentin secondary caries in primary teeth restored with amalgam.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Onion (Allium cepa) is one of the most cultivated and consumed vegetables in Brazil and its importance is due to the large laborforce involved. One of the main pests that affect this crop is the Onion Thrips (Thrips tabaci), but the spatial distribution of this insect, although important, has not been considered in crop management recommendations, experimental planning or sampling procedures. Our purpose here is to consider statistical tools to detect and model spatial patterns of the occurrence of the onion thrips. In order to characterize the spatial distribution pattern of the Onion Thrips a survey was carried out to record the number of insects in each development phase on onion plant leaves, on different dates and sample locations, in four rural properties with neighboring farms under different infestation levels and planting methods. The Mantel randomization test proved to be a useful tool to test for spatial correlation which, when detected, was described by a mixed spatial Poisson model with a geostatistical random component and parameters allowing for a characterization of the spatial pattern, as well as the production of prediction maps of susceptibility to levels of infestation throughout the area.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

To determine the presence of Brucella ovis in ovine from Paraíba State, in the Northeast region of Brazil, 80 animals slaughtered in the public slaughterhouse of Patos city were used. Before slaughter, blood samples were collected by jugular venopuncture from each animal, and after slaughter, testicles, epidydimus and uterus were aseptically collected. For the serological diagnosis of B. ovis and B. abortus infections, the agar gel immunodiffusion (AGID) and Rose Bengal (RBT) tests were carried out, respectively. In addition, microbiological culture and polymerase chain reaction (PCR) were performed on testicle, epidydimus and uterus samples. Six animals (7.5%) tested positive for the presence of B. ovis antibodies and all animals tested negative for the presence of B. abortus antibodies. One AGID-positive animal tested positive at uterine swab culture. PCR was able to amplify DNA of Brucella spp. from the pool of testicle, epidydimus and uterus samples from AGID-positive animals. This is the first report of isolation and detection of B. ovis DNA by PCR in ovine from the Northeast region of Brazil.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The objective of the present study was to improve the detection of B. abortus by PCR in organs of aborted fetuses from infected cows, an important mechanism to find infected herds on the eradication phase of the program. So, different DNA extraction protocols were compared, focusing the PCR detection of B. abortus in clinical samples collected from aborted fetuses or calves born from cows challenged with the 2308 B. abortus strain. Therefore, two gold standard groups were built based on classical bacteriology, formed from: 32 lungs (17 positives), 26 spleens (11 positives), 23 livers (8 positives) and 22 bronchial lymph nodes (7 positives). All samples were submitted to three DNA extraction protocols, followed by the same amplification process with the primers B4 and B5. From the accumulated results for organ, the proportion of positives for the lungs was higher than the livers (p=0.04) or bronchial lymph nodes (p=0.004) and equal to the spleens (p=0.18). From the accumulated results for DNA extraction protocol, the proportion of positives for the Boom protocol was bigger than the PK (p<0.0001) and GT (p=0.0004). There was no difference between the PK and GT protocols (p=0.5). Some positive samples from the classical bacteriology were negative to the PCR and viceversa. Therefore, the best strategy for B. abortus detection in the organs of aborted fetuses or calves born from infected cows is the use, in parallel, of isolation by classical bacteriology and the PCR, with the DNA extraction performed by the Boom protocol.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Technical evaluation of analytical data is of extreme relevance considering it can be used for comparisons with environmental quality standards and decision-making as related to the management of disposal of dredged sediments and the evaluation of salt and brackish water quality in accordance with CONAMA 357/05 Resolution. It is, therefore, essential that the project manager discusses the environmental agency's technical requirements with the laboratory contracted for the follow-up of the analysis underway and even with a view to possible re-analysis when anomalous data are identified. The main technical requirements are: (1) method quantitation limits (QLs) should fall below environmental standards; (2) analyses should be carried out in laboratories whose analytical scope is accredited by the National Institute of Metrology (INMETRO) or qualified or accepted by a licensing agency; (3) chain of custody should be provided in order to ensure sample traceability; (4) control charts should be provided to prove method performance; (5) certified reference material analysis or, if that is not available, matrix spike analysis, should be undertaken and (6) chromatograms should be included in the analytical report. Within this context and with a view to helping environmental managers in analytical report evaluation, this work has as objectives the discussion of the limitations of the application of SW 846 US EPA methods to marine samples, the consequences of having data based on method detection limits (MDL) and not sample quantitation limits (SQL), and present possible modifications of the principal method applied by laboratories in order to comply with environmental quality standards.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The naturally occurring clonal diversity among field isolates of the major human malaria parasite Plasmodium vivax remained unexplored until the early 1990s, when improved molecular methods allowed the use of blood samples obtained directly from patients, without prior in vitro culture, for genotyping purposes. Here we briefly review the molecular strategies currently used to detect genetically distinct clones in patient-derived P. vivax samples, present evidence that multiple-clone P. vivax infections are commonly detected in areas with different levels of malaria transmission and discuss possible evolutionary and epidemiological consequences of the competition between genetically distinct clones in natural human infections. We suggest that, when two or more genetically distinct clones are present in the same host, intra-host competition for limited resources may select for P. vivax traits that represent major public health challenges, such as increased virulence, increased transmissibility and antimalarial drug resistance.