854 resultados para Extensional events


Relevância:

80.00% 80.00%

Publicador:

Resumo:

In Eastern South America, a series of fault-bounded sedimentary basins that crop out from Southern Uruguay to Southeastern Brazil were formed after the main collisional deformation of the Brasiliano Orogeny and record the tectonic events that affected the region from the Middle Ediacaran onwards. We address the problem of discerning the basin-forming tectonics from the later deformational events through paleostress analysis of more than 600 fault-slip data, mainly from the Camaquã Basin (Southern Brazil), sorted by stratigraphic level and cross-cutting relationships of superposed striations, and integrated with available stratigraphic and geochronological data. Our results show that the Camaquã Basin was formed by at least two distinct extensional events, and that rapid paleostress changes took place in the region a few tens of million years after the major collision (c.a. 630 Ma), probably due to the interplay between local active extensional tectonics and the distal effects of the continued amalgamation of plates and terranes at the margins of the still-forming Gondwana Plate. Preliminary paleostress data from the Castro Basin and published data from the Itajaí Basin suggest that these events had a regional nature.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The results of geological mapping, chemical analysis and radiometric dating of metabasic rocks of Betara Formation, and mapping and dating of those present in the Betara basement nucleus together with mylonitic granodiorite and syenogranite are reported here. U-Pb analysis of bulk zircon fractions from the metabasic rocks of the basement nucleus yielded a Statherian age of 1790 +/- 22 Ma, while the metabasic rocks from the upper part of the Betara Formation yielded a Calymmian age between 1500 and 1450 Ma. This age is a minimum for the deposition of the Betara Formation. The older metabasic rocks are associated with post-tectonic, possibly anorogenic syenogranite, while the younger ones are gabbro or very porphyritic ankaramite whose REE patterns are consistent with crystallization from an N-MORB parent magma. The observations and data point to the probable events associated with extensional processes of the end of Paleoproterozoic and early Mesoproterozoic. Similar registers of Statherian (1.80-1.75 Ga) and Calymmian (1.50-1.45 Ga) extensional events are recorded in other parts of the South American and African continents. The Neoproterozoic witnessed the formation and junction of the tectonic slices which formed the Apiai domain during the assemblage of western Gondwana. (C) 2010 International Association for Gondwana Research. Published by Elsevier B.V. All rights reserved.

Relevância:

70.00% 70.00%

Publicador:

Resumo:

The neoformation of chlorite and K-white mica in fault rocks from two main faults of the central Catalan Coastal Ranges, the Vallès and the Hospital faults, has allowed us to constrain the P–T conditions during fault evolution using thermodynamic modeling. Crystallization of M1 and M2 muscovite and microcline occured as result of deuteric alteration during the exhumation of the pluton (290 °C > T > 370 °C) in the Permian. After that, three tectonic events have been distinguished. The first tectonic event, attributed to the Mesozoic rifting, is characterized by precipitation of M3 and M4 phengite together with chlorite and calcite C1 at temperatures between 190 and 310 °C. The second tectonic event attributed to the Paleogene compression has only been identified in the Hospital fault with precipitation of low-temperature calcite C2. The shortcut produced during inversion of the Vallès fault was probably the responsible for the lack of neoformed minerals within this fault. Finally, the third tectonic event, which is related to the Neogene extension, is characterized in the Vallès fault by a new generation of chlorite, associated with calcite C4 and laumontite, formed at temperatures between 125 and 190 °C in the absence of K-white mica. Differently, the Hospital fault is characterized by the precipitation of calcite C3 during the syn-rift stage at temperatures around 150 °C and by low-temperature fluids precipitating calcites C5, C6 and PC1 during the post-rift stage. During the two extensional events (Mesozoic and Neogene), faults acted as conduits for hot fluids producing anomalous high geothermal gradients (50 °C/km minimum).

Relevância:

60.00% 60.00%

Publicador:

Resumo:

Abstract The purpose of this study is to unravel the geodynamic evolution of Thailand and, from that, to extend the interpretation to the rest of Southeast Asia. The methodology was based in a first time on fieldwork in Northern Thailand and Southernmost Myanmar, using a multidisciplinary approach, and then on the compilation and re-interpretation, in a plate tectonics point of view, of existing data about the whole Southeast Asia. The main results concern the Nan-Uttaradit suture, the Chiang Mai Volcanic Belt and the proposition of a new location for the Palaeotethys suture. This led to the establishment of a new plate tectonic model for the geodynamic evolution of Southeast Asia, implying the existence new terranes (Orang Laut and the redefinition of Shan-Thai) and the role of the Palaeopacific Ocean in the tectonic development of the area. The model proposed here considers the Palaeotethys suture as located along the Tertiary Mae Yuam Fault, which represents the divide between the Cimmerian Sibumasu terrane and the Indochina-derived Shan-Thai block. The term Shan-Thai, previously used to define the Cimmerian area (when the Palaeotethys suture was thought to represented by the Nan-Uttaradit suture), was redefined here by keeping its geographical location within the Shan States of Myanmar and Central-Northern Thailand, but attributing it an East Asian Origin. Its detachment from Indochina was the result of the Early Permian opening of the Nan basin. The Nan basin closed during the Middle Triassic, before the deposition of Carnian-Norian molasse. The modalities of the closure of the basin imply a first phase of Middle Permian obduction, followed by final eastwards subduction. The Chiang Mai Volcanic Belt consists of scattered basaltic rocks erupted at least during the Viséan in an extensional continental intraplate setting, on the Shan-Thai part of the Indochina block. The Viséan age was established by the dating of limestone stratigraphically overlying the basalts. In several localities of the East Asian Continent, coeval extensional features occur, possibly implying one or more Early Carboniferous extensional events at a regional scale. These events occurred either due to the presence of a mantle plume or to the roll-back of the Palaeopacific Ocean, subducting beneath Indochina and South China, or both. The Palaeopacific Ocean is responsible, during the Early Permian, for the opening of the Song Ma and Poko back-arcs (Vietnam) with the consequent detachment of the Orang Laut Terranes (Eastern Vietnam, West Sumatra, Kalimantan, Palawan, Taiwan). The Late Triassic/Early Jurassic closure of the Eastern Palaeotethys is considered as having taken place by subduction beneath its southern margin (Gondwana), due to the absence of Late Palaeozoic arc magmatism on its northern (Indochinese) margin and the presence of volcanism on the Cimmerian blocks (Mergui, Lhasa). Résumé Le but de cette étude est d'éclaircir l'évolution géodynamique de la Thaïlande et, à partir de cela, d'étendre l'interprétation au reste de l'Asie du Sud-Est. La méthodologie utilisée est basée dans un premier temps sur du travail de terrain en Thaïlande du nord et dans l'extrême sud du Myanmar, en se basant sur une approche pluridisciplinaire. Dans un deuxième temps, la compilation et la réinterprétation de données préexistantes sur l'Asie du Sud-est la été faite, dans une optique basée sur la tectonique des plaques. Les principaux résultats de ce travail concernent la suture de Nan-Uttaradit, la « Chiang Mai Volcanic Belt» et la proposition d'une nouvelle localité pour la suture de la Paléotethys. Ceci a conduit à l'établissement d'un nouveau modèle pour l'évolution géodynamique de l'Asie du Sud-est, impliquant l'existence de nouveaux terranes (Orang Laut et Shan-Thai redéfini) et le rôle joué par le Paléopacifique dans le développement tectonique de la région. Le modèle présenté ici considère que la suture de la Paléotethys est située le long de la faille Tertiaire de Mae Yuam, qui représente la séparation entre le terrain Cimmérien de Sibumasu et le bloc de Shan-Thai, d'origine Indochinoise. Le terme Shan-Thai, anciennement utilise pour définir le bloc Cimmérien (quand la suture de la Paléotethys était considérée être représentée par la suture de Nan-Uttaradit), a été redéfini ici en maintenant sa localisation géographique dans les états Shan du Myanmar et la Thaïlande nord-centrale, mais en lui attribuant une origine Est Asiatique. Son détachement de l'Indochine est le résultat de l'ouverture du basin de Nan au Permien Inférieur. Le basin de Nan s'est fermé pendant le Trias Moyen, avant le dépôt de molasse Carnienne-Norienne. Les modalités de fermeture du basin invoquent une première phase d'obduction au Permien Moyen, suivie par une subduction finale vers l'est. La "Chiang Mai Volcanic Belt" consiste en des basaltes éparpillés qui ont mis en place au moins pendant le Viséen dans un contexte extensif intraplaque continental sur la partie de l'Indochine correspondant au bloc de Shan-Thai. L'âge Viséen a été établi sur la base de la datation de calcaires qui surmontent stratigraphiquement les basaltes. Dans plusieurs localités du continent Est Asiatique, des preuves d'extension plus ou moins contemporaines ont été retrouvées, ce qui implique l'existence d'une ou plusieurs phases d'extension au Carbonifère Inférieur a une échelle régionale. Ces événements sont attribués soit à la présence d'un plume mantellique, ou au rollback du Paléopacifique, qui subductait sous l'Indochine et la Chine Sud, soit les deux. Pendant le Permien inférieur, le Paléopacifique est responsable pour l'ouverture des basins d'arrière arc de Song Ma et Poko (Vietnam), induisant le détachement des Orang Laut Terranes (Est Vietnam, Ouest Sumatra, Kalimantan, Palawan, Taiwan). La fermeture de la Paléotethys Orientale au Trias Supérieur/Jurassique Inférieur est considérée avoir eu lieu par subduction sous sa marge méridionale (Gondwana), à cause de l'absence de magmatisme d'arc sur sa marge nord (Indochinoise) et de la présence de volcanisme sur les blocs Cimmériens de Lhassa et Sibumasu (Mergui). Résumé large public L'histoire géologique de l'Asie du Sud-est depuis environ 430 millions d'années a été déterminée par les collisions successives de plusieurs continents les uns avec les autres. Il y a environ 430 millions d'années, au Silurien, un grand continent appelé Gondwana, a commencé à se «déchirer» sous l'effet des contraintes tectoniques qui le tiraient. Cette extension a provoqué la rupture du continent et l'ouverture d'un grand océan, appelé Paléotethys, éloignant les deux parties désormais séparées. C'est ainsi que le continent Est Asiatique, composé d'une partie de la Chine actuelle, de la Thaïlande, du Myanmar, de Sumatra, du Vietnam et de Bornéo a été entraîné avec le bord (marge) nord de la Paléotethys, qui s'ouvrait petit à petit. Durant le Carbonifère Supérieur, il y a environ 300 millions d'années, le sud du Gondwana subissait une glaciation, comme en témoigne le dépôt de sédiments glaciaires dans les couches de cet âge. Au même moment le continent Est Asiatique se trouvait à des latitudes tropicales ou équatoriales, ce qui permettait le dépôt de calcaires contenant différents fossiles de foraminifères d'eau chaude et de coraux. Durant le Permien Inférieur, il y a environ 295 millions d'années, la Paléotethys Orientale, qui était un relativement vieil océan avec une croûte froide et lourde, se refermait. La croûte océanique a commencé à s'enfoncer, au sud, sous le Gondwana. C'est ce que l'on appelle la subduction. Ainsi, le Gondwana s'est retrouvé en position de plaque supérieure, par rapport à la Paléotethys qui, elle, était en plaque inférieure. La plaque inférieure en subductant a commencé à reculer. Comme elle ne pouvait pas se désolidariser de la plaque supérieure, en reculant elle l'a tirée. C'est le phénomène du «roll-back ». Cette traction a eu pour effet de déchirer une nouvelle fois le Gondwana, ce qui a résulté en la création d'un nouvel Océan, la Neotethys. Cet Océan en s'ouvrant a déplacé une longue bande continentale que l'on appelle les blocs Cimmériens. La Paléotethys était donc en train de se fermer, la Neotethys de s'ouvrir, et entre deux les blocs Cimmériens se rapprochaient du Continent Est Asiatique. Pendant ce temps, le continent Est Asiatique était aussi soumis à des tensions tectoniques. L'Océan Paléopacifique, à l'est de celui-ci, était aussi en train de subducter. Cette subduction, par roll-back, a déchiré le continent en détachant une ligne de microcontinents appelés ici « Orang Laut Terranes », séparés du continent par deux océans d'arrière arc : Song Ma et Poko. Ceux-ci sont composés de Taiwan, Palawan, Bornéo ouest, Vietnam oriental, et la partie occidentale de Sumatra. Un autre Océan s'est ouvert pratiquement au même moment dans le continent Est Asiatique : l'Océan de Nan qui, en s'ouvrant, a détaché un microcontinent appelé Shan-Thai. La fermeture de l'Océan de Nan, il y a environ 230 millions d'années a resolidarisé Shan-Thai et le continent Est Asiatique et la trace de cet événement est aujourd'hui enregistrée dans la suture (la cicatrice de l'Océan) de Nan-Uttaradit. La cause de l'ouverture de l'Océan de Nan peut soit être due à la subduction du Paléopacifique, soit aux fait que la subduction de la Paléotethys tirait le continent Est Asiatique par le phénomène du « slab-pull », soit aux deux. La subduction du Paléopacifique avait déjà crée de l'extension dans le continent Est Asiatique durant le Carbonifère Inférieur (il y a environ 340-350 millions d'années) en créant des bassins et du volcanisme, aujourd'hui enregistré en différents endroits du continent, dont la ceinture volcanique de Chiang Mai, étudiée ici. A la fin du Trias, la Paléotethys se refermait complètement, et le bloc Cimmérien de Sibumasu entrait en collision avec le continent Est Asiatique. Comme c'est souvent le cas avec les grands océans, il n'y a pas de suture proprement dite, avec des fragments de croûte océanique, pour témoigner de cet évènement. Celui-ci est visible grâce à la différence entre les sédiments du Carbonifère Supérieur et du Permieñ Inférieur de chaque domaine : dans le domaine Cimmérien ils sont de type glaciaire alors que dans le continent Est Asiatique ils témoignent d'un climat tropical. Les océans de Song Ma et Poko se sont aussi refermés au Trias, mais eux ont laissé des sutures visibles

Relevância:

60.00% 60.00%

Publicador:

Resumo:

New plate-tectonic reconstructions of the Gondwana margin suggest that the location of Gondwana-derived terranes should not only be guided by the models, but should also consider the possible detrital input from some Asian blocks (Hunia), supposed to have been located along the Cambrian Gondwana margin, and accreted in the Silurian to the North-Chinese block. Consequently, the Gondwana margin has to be subdivided into a more western domain, where the future Avalonian blocks will be separated from Gondwana by the opening Rheic Ocean, whereas in its eastern continuation, hosting the future basement areas of Central Europe, different periods of crustal extension should be distinguished. Instead of applying a rather cylindrical model, it is supposed that crustal extension follows a much more complex pattern, where local back-arcs or intra-continental rifts are involved. Guided by the age data of magmatic rocks and the pattern of subsidence curves, the following extensional events can be distinguished: During the early to middle Cambrian, a back-arc setting guided the evolution at the Gondwana margin. Contemporaneous intra-continental rift basins developed at other places related to a general post-PanAfrican extensional phase affecting Africa Upper Cambrian formation of oceanic crust is manifested in the Chamrousse area, and may have lateral cryptic relics preserved in other places. This is regarded as the oceanisation of some marginal basins in a context of back-arc rifting. These basins were closed in a mid-Ordovician tectonic phase, related to the subduction of buoyant material (mid-ocean ridge?) Since the Early Ordovician, a new phase of extension is observed, accompanied by a large-scale volcanic activity, erosion of the rift shoulders generated detritus (Armorican Quartzite) and the rift basins collected detrital zircons from a wide hinterland. This phase heralded the opening of Palaeotethys, but it failed due to the Silurian collision (Eo-Variscan phase) of an intra-oceanic arc with the Gondwana margin. During this time period, at the eastern wing of the Gondwana margin begins the drift of the future Hunia microcontinents, through the opening of an eastern prolongation of the already existing Rheic Ocean. The passive margin of the remaining Gondwana was composed of the Galatian superterranes, constituents of the future Variscan basement areas. Remaining under the influence of crustal extension, they will start their drift to Laurussia since the earliest Devonian during the opening of the Palaeotethys Ocean. (C) 2008 Elsevier B.V. All rights reserved.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

The extension of the Pangaea started in the Upper Triassic and evolved to uplifts, magmatism and development a triple junction during the Mesozoic, and opening the Central Atlantic Ocean. The Brazilian Equatorial Atlantic margin was formed in three Mesozoic extensional events. The first event is recorded by the Calçoene Graben of the Foz do Amazonas Basin. The second event started in the Valangian and is recognized by the enlargement of the Foz do Amazonas Basin, formation of the Marajó and Grajaú basins, and the Gurupi Graben System. The third event commenced in the Albian related to northwestward progression of the rift system, which enlarged the Foz do Amazonas and formed the Potiguar, Ceará, Barreirinhas and Pará-Maranhão basins. At the end of the Lower Cretaceous the movements attenuated in the Marajó Basin and Gurupi Graben System; the extension concentrated in the Foz do Amazonas, Pará-Maranhão and Barreirinhas basins, and evolved to continental rupture of northern South America and western Africa opening of the Equatorial Atlantic Ocean.

Relevância:

60.00% 60.00%

Publicador:

Resumo:

In the Mt. Olympos region of northeastern Greece, continental margin strata and basement rocks were subducted and metamorphosed under blueschist facies conditions, and thrust over carbonate platform strata during Alpine orogenesis. Subsequent exposure of the subducted basement rocks by normal faulting has allowed an integrated study of the timing of metamorphism, its relationship to deformation, and the thermal history of the subducted terrane. Alpine low-grade metamorphic assemblages occur at four structural levels. Three thrust sheets composed of Paleozoic granitic basement and Mesozoic metasedimentary cover were thrust over Mesozoic carbonate rocks and Eocene flysch; thrusting and metamorphism occurred first in the highest thrust sheets and progressed downward as units were imbricated from NE to SW. 40Ar/39Ar spectra from hornblende, white mica, and biotite samples indicate that the upper two units preserve evidence of four distinct thermal events: (1) 293–302 Ma crystallization of granites, with cooling from >550°C to <325°C by 284 Ma; (2) 98–100 Ma greenschist to blueschist-greenschist transition facies metamorphism (T∼350–500°C) and imbrication of continental thrust sheets; (3) 53–61 Ma blueschist facies metamorphism and deformation of the basement and continental margin units at T<350–400°C; (4) 36–40 Ma thrusting of blueschists over the carbonate platform, and metamorphism at T∼200–350°C. Only the Eocene and younger events affected the lower two structural packages. A fifth event, indicated by diffusive loss profiles in microcline spectra, reflects the beginning of uplift and cooling to T<100–150°C at 16–23 Ma, associated with normal faulting which continued until Quaternary time. Incomplete resetting of mica ages in all units constrains the temperature of metamorphism during continental subduction to T≤350°C, the closure temperature for Ar in muscovite. The diffusive loss profiles in micas and K-feldspars enable us to “see through” the younger events to older events in the high-T parts of the release spectra. Micas grown during earlier metamorphic events lost relatively small amounts of Ar during subsequent high pressure-low temperature metamorphism. Release spectra from phengites grown during Eocene metamorphism and deformation record the ages of the Ar-loss events. Alpine deformation in northern Greece occurred over a long time span (∼90 Ma), and involved subduction and episodic imbrication of continental basement before, during, and after the collision of the Apulian and Eurasian plates. Syn-subduction uplift and cooling probably combined with intermittently higher cooling rates during extensional events to preserve the blueschist facies mineral assemblages as they were exhumed from depths of >20 km. Extension in the Olympos region was synchronous with extension in the Mesohellenic trough and the Aegean back-arc, and concurrent with westward-progressing shortening in the external Hellenides.

Relevância:

40.00% 40.00%

Publicador:

Resumo:

The structural position of the Upper Jurassic-Lower Cretaceous carbonates located in the central part of the Catalan Coastal Ranges corresponds to the southwestern end of the Vallès-Penedès Fault. This fault was reactivated at different times during successive extensional and compressional events and several generations of fractures and cementations were formed.

Relevância:

30.00% 30.00%

Publicador:

Resumo:

During the Ediacaran, southern Brazil was the site of multiple episodes of volcanism and sedimentation, which are best preserved in the 3000 km(2) Camaqua Basin. The interlayered sedimentary and volcanic rocks record tectonic events and paleoenvironmental changes in a more than 10 km-thick succession. In this contribution, we report new U-Pb and Sm-Nd geochronological constraints for the 605 to 580 Ma Born Jardim Group, the 570 Ma Acampamento Velho Formation, and a newly-recognized 544 Ma volcanism. Depositional patterns of these units reveal the transition from a restricted, fault-bounded basin into a wide, shallow basin. The expansion of the basin and diminished subsidence rates are demonstrated by increasing areal distribution and compressed isopachs and increasing onlap of sediments onto the basement to the west. The Sm-Nd isotopic composition of the volcanic rocks indicates mixed sources, including crustal rocks from the adjacent basement. Both Neoproterozoic and Paleoproterozoic sources are indicated for the western part of the basin, whereas only the older Paleoproterozoic signature can be discerned in the eastern part of the basin. (C) 2011 International Association for Gondwana Research. Published by Elsevier B.V. All rights reserved.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

INTRODUCTION: Data is scarce regarding adverse events (AE) of biological therapy used in the management of Crohn's Disease (CD) among Brazilian patients. OBJECTIVES: To analyse AE prevalence and profile in patients with CD treated with Infliximab (IFX) or Adalimumab (ADA) and to verify whether there are differences between the two drugs. METHOD: Retrospective observational single-centre study of CD patients on biological therapy. Variables analysed: Demographic data, Montreal classification, biological agent administered, treatment duration, presence and type of AE and the need for treatment interruption. RESULTS: Forty-nine patients were analysed, 25 treated with ADA and 24 with IFX. The groups were homogeneous in relation to the variables studied. The average follow-up period for the group treated with ADA was 19.3 months and 21.8 months for the IFX group (p = 0.585). Overall, 40% (n = 10) of patients taking ADA had AE compared with 50% (n = 12) of IFX users (p = 0.571). There was a tendency towards higher incidence of cutaneous and infusion reactions in the IFX group and higher incidence of infections in the ADA treated group, although without significant difference. CONCLUSIONS: No difference was found in the AE prevalence and profile between ADA and IFX CD patients in the population studied.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

The present study evaluated the progression of osteogenic cell cultures exposed to a novel calcium aluminate cement (CAC+) in comparison with the gold standard mineral trioxide aggregate (MTA). Cells were enzimatically isolated from newborn rat calvarial bone, plated on glass coverslips containing either CAC+ or a control MTA samples in the center, and grown under standard osteogenic conditions. Over the 10-day culture period, roundening of sample edges was clearly noticed only for MTA group. Although both cements supported osteogenic cell adhesion, spreading, and proliferation, CAC+-exposed cultures showed significantly higher values in terms of total cell number at days 3 and 7, and total protein content and alkaline phosphatase activity at day 10. The present in vitro results indicate that the exposure to CAC+ supports a higher differentiation of osteogenic cells compared with the ones exposed to MTA. Further experimental studies should consider CAC+ as a potential alternative to MTA when the repair of mineralized tissues is one of the desired outcomes in endodontic therapy.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Happy emotional states have not been extensively explored in functional magnetic resonance imaging studies using autobiographic recall paradigms. We investigated the brain circuitry engaged during induction of happiness by standardized script-driven autobiographical recall in 11 healthy subjects (6 males), aged 32.4 ± 7.2 years, without physical or psychiatric disorders, selected according to their ability to vividly recall personal experiences. Blood oxygen level-dependent (BOLD) changes were recorded during auditory presentation of personal scripts of happiness, neutral content and negative emotional content (irritability). The same uniform structure was used for the cueing narratives of both emotionally salient and neutral conditions, in order to decrease the variability of findings. In the happiness relative to the neutral condition, there was an increased BOLD signal in the left dorsal prefrontal cortex and anterior insula, thalamus bilaterally, left hypothalamus, left anterior cingulate gyrus, and midportions of the left middle temporal gyrus (P < 0.05, corrected for multiple comparisons). Relative to the irritability condition, the happiness condition showed increased activity in the left insula, thalamus and hypothalamus, and in anterior and midportions of the inferior and middle temporal gyri bilaterally (P < 0.05, corrected), varying in size between 13 and 64 voxels. Findings of happiness-related increased activity in prefrontal and subcortical regions extend the results of previous functional imaging studies of autobiographical recall. The BOLD signal changes identified reflect general aspects of emotional processing, emotional control, and the processing of sensory and bodily signals associated with internally generated feelings of happiness. These results reinforce the notion that happiness induction engages a wide network of brain regions.

Relevância:

20.00% 20.00%

Publicador:

Resumo:

Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq)

Relevância:

20.00% 20.00%

Publicador:

Resumo:

We estimated the sensitivity, i.e., the proportion of all cases of adverse events following immunization (AEFIs) reported to the Brazilian passive surveillance for adverse events following immunization (PSAEFI) with the diphtheria-tetanus-whole-cell pertussis-Haemophilus influenzae type b (DTwP-Hib) vaccine, as well as investigating factors associated with AEFIs reporting. During 2003–2004, 8303 AEFIs associated with DTwP-Hib were reported; hypotonic-hyporesponsive episodes (HHEs), fever and convulsions being the most common. Cure without sequel was achieved in 98.4 per cent of the cases. The mean sensitivity of the PSAEFI was 22.3 per cent and 31.6 per cent, respectively, for HHE and convulsions, varying widely among states. Reporting rates correlated positively with the Human Development Index and coverage of adequate prenatal care, correlating negatively with infant mortality rates. Quality of life indicators and the degree of organization of health services are associated with greater PSAEFI sensitivity. In addition to consistently describing the principal AEFIs, PSAEFI showed the DTwP/Hib vaccine to be safe and allayed public fears related to its use