A proteomic approach to identifying proteins differentially expressed in conidia and mycelium of the entomopathogenic fungus Metarhizium acridum

Metarhizium spp. is an important worldwide group of entomopathogenic fungi used as an interesting alternative to chemical insecticides in programs of agricultural pest and disease vector control. Metarhizium conidia are important in fungal propagation and also are responsible for host infection. Despite their importance, several aspects of conidial biology, including their proteome, are still unknown. We have established conidial and mycelial proteome reference maps for Metarhizium acridum using two-dimensional gel electrophoresis (2-DE) and matrix-assisted laser desorption/ionization-time of flight-mass spectrometry (MALDI-TOF MS). In all, 1130 +/- 102 and 1200 +/- 97 protein spots were detected in ungerminated conidia and fast-growing mycelia, respectively. Comparison of the two protein-expression profiles reveled that only 35 % of the protein spots were common to both developmental stages. Out of 94 2-DE protein spots (65 from conidia, 25 from mycelia and two common to both) analyzed using mass spectrometry, seven proteins from conidia, 15 from mycelia and one common to both stages were identified. The identified protein spots exclusive to conidia contained sequences similar to known fungal stress-protector proteins (such as heat shock proteins (HSP) and 6-phosphogluconate dehydrogenase) plus the fungal allergen Alt a 7, actin and the enzyme cobalamin-independent methionine synthase. The identified protein spots exclusive to mycelia included proteins involved in several cell housekeeping biological processes. Three proteins (HSP 90, 6-phosphogluconate dehydrogenase and allergen Alt a 7) were present in spots in conidial and mycelial gels, but they differed in their locations on the two gels. (c) 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Production technology for entomopathogenic fungus using a biphasic culture system

The objective of this research was to evaluate combinations of liquid media obtained from agro-industrial residues and by-products, with solid media prepared with mixtures of grains and their derivatives, aiming to increase the production of JAB 02 and JAB 45 isolates of Lecanicillium lecanii. Sporulation, conidial viability and process yield were evaluated as well as the production costs using the JAB 45 isolate as a model system were analyzed. The production of JAB 02 was not increased using the biphasic culture. For JAB 45, some combinations provided an increase in yield, especially cheese whey with wheat bran and wheat grain, with lower production costs. Viability was not influenced by the production method, and the combinations showed no differences in the process yield. The biphasic method is suitable for the production of L. lecanii, and proves to be an appropriate technology to use in mass production by biofactories.

Gypsy moths (Lymantria dispar) in the Niagara Region : population density variation, introduction of an entomopathogenic fungus (Entomophaga maimaiga) and occurrence of nuclear polyhedrosis virus

The gypsy moth, Lymantria dispar, a major defoliator of broad leaf trees, was accidentally introduced into North America in 1869. Much interest has been generated regarding the potential of using natural pathogens for biological control of this insect. One of these pathogens, a highly specific fungus, Entomophaga maimaiga, was accredited with causing major epizootics in populations of gypsy moth across the north-eastern United States in 1989 and 1990 and is thought to be spreading northwards into Canada. This study examined gypsy moth population densities in the Niagara Region. The fungus, .E.. maimaiga, was artificially introduced into one site and the resulting mortality in host populations was noted over two years. The relationship between fungal mortality, host population density and occurrence of another pathogen, the nuclear polyhedrosis virus (NPV), was assessed. Gypsy moth population density was assessed by counting egg masses in 0.01 hectare (ha) study plots in six areas, namely Louth, Queenston, Niagara-on-the-Lake, Shorthills Provincial Park, Chippawa Creek and Willoughby Marsh. High variability in density was seen among sites. Willoughby Marsh and Chippawa Creek, the sites with the greatest variability, were selected for more intensive study. The pathogenicity of E. maimaiga was established in laboratory trials. Fungal-infected gypsy moth larvae were then released into experimental plots of varying host density in Willoughby Marsh in 1992. These larvae served as the inoculum to infect field larvae. Other larvae were injected with culture medium only and released into control plots also of varying host density. Later, field larvae were collected and assessed for the presence of .E.. maimaiga and NPV. A greater proportion of larvae were infected from experimental plots than from control plots indicating that the experimental augmentation had been successful. There was no relationship between host density and the proportion of infected larvae in either experimental or control plots. In 1992, 86% of larvae were positive for NPV. Presence and intensity of NPV infection was independent of fungal presence, plot type or interaction of these two factors. Sampling was carried out in the summer of 1993, the year after the introduction, to evaluate the persistence of the pathogen in the environment. Almost 50% of all larvae were infected with the fungus. There was no difference between control and experimental plots. Data collected from Willoughby Marsh indicated that there was no correlation between the proportion of larvae infected with the fungus and host population density in either experimental or control plots. About 10% of larvae collected from a nearby site, Chippawa Creek, were also positive for .E.. maimaiga suggesting that low levels of .E.. maimaiga probably occurred naturally in the area. In 1993, 9.6% of larvae were positive for NPV. Again, presence or absence of NPV infection was independent of fungal presence plot type or interaction of these two factors. In conclusion, gypsy moth population densities were highly variable between and within sites in the Niagara Region. The introduction of the pathogenic fungus, .E.. maimaiga, into Willoughby Marsh in 1992 was successful and the fungus was again evident in 1993. There was no evidence for existence of a relationship between fungal mortality and gypsy moth density or occurrence of NPV. The results from this study are discussed with respect to the use of .E.. maimaiga in gypsy moth management programs.

Starvation Induces Expression of the Plant-Adhesin Gene, Mad2, of the Entomopathogenic Fungus Metarhizium robertsii.

Metarhizium robertsii is an entomopathogenic fungus that is additionally plant rhizosphere competent. Two adhesin-encoding gens, Mad1 and Mad2, are involved in insect pathogenesis or plant root colonization, respectively. This study examined differential expression of the Mad genes for M robertsii grown on a variety of insectand plant-related substrates. Mad1 was up regulated in response to insect cuticles and up regulation of Mad2 resulted from root exudates, tomato stems and non-preferred carbohydrates. A time course analysis that compared water, minimal media, and nutrient rich broth revealed Mad2 gene expression increased as nutrient availability decreased. The regulation of Mad2 compared to known stress-related genes (Hsp30, Hsp70 and ssgA) under various stresses (nutrient, pH, osmotic, oxidative, temperature) revealed Mad2 to be generally up regulated by nutrient starvation only. Examination of the Mad2 promoter region revealed two copies of a stress-response element (S TRE) known to be regulated under the general stress response pathway.

Production technology for entomopathogenic fungus using a biphasic culture system

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Susceptibility of adult and larval stages of the horn fly, Haematobia irritans, to the entomopathogenic fungus Metarhizium anisopliae under field conditions

Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP)

Characterization of a new toxin from the entomopathogenic fungus Metarhizium anisopliae: the ribotoxin anisoplin

Metarhizium anisopliae is an entomopathogenic fungus relevant in biotechnology with applications like malaria vector control. Studies of its virulence factors are therefore of great interest. Fungal ribotoxins are toxic ribonucleases with extraordinary efficiency against target ribosomes and suggested as potential insecticides. Here, we describe this ribotoxin characteristic activity in M. anisopliae cultures. Anisoplin has been obtained as a recombinant protein and further characterized. It is structurally similar to hirsutellin A, the ribotoxin from the entomopathogen Hirsutella thompsonii. Moreover, anisoplin shows the ribonucleolytic activity typical of ribotoxins and cytotoxicity against insect cells. How Metarhizium uses this toxin and possible applications are on perspective.

Characterization of a new toxin from the entomopathogenic fungus Metarhizium anisopliae: the ribotoxin anisoplin

Metarhizium anisopliae is an entomopathogenic fungus relevant in biotechnology with applications like malaria vector control. Studies of its virulence factors are therefore of great interest. Fungal ribotoxins are toxic ribonucleases with extraordinary efficiency against target ribosomes and suggested as potential insecticides. Here, we describe this ribotoxin characteristic activity in M. anisopliae cultures. Anisoplin has been obtained as a recombinant protein and further characterized. It is structurally similar to hirsutellin A, the ribotoxin from the entomopathogen Hirsutella thompsonii. Moreover, anisoplin shows the ribonucleolytic activity typical of ribotoxins and cytotoxicity against insect cells. How Metarhizium uses this toxin and possible applications are on perspective.

Endophytic and entomopathogenic strains of Beauveria sp to control the bovine tick Rhipicephalus (Boophilus) microplus

Pathogenicity of strains of the entomopathogenic fungus Beauveria bassiana and endophytic strains of Beauveria sp against the bovine tick Rhipicephalus (Boophilus) microplus was tested in laboratory bioassays and under field conditions. Suspensions containing 10(5), 10(7) and 10(9) conidia/mL were prepared of each fungal strain for laboratory bioassays. The ticks were maintained at 28 degrees C, 90 +/- 5% relative humidity, and the following variables were evaluated: initial female weight, egg weight, hatching percentage, reproductive efficiency, and percentage control. For tests under field conditions, a Beauveria suspension containing 10(6) conidia/mL was sprayed on tick-infested cows. After 72 h, the ticks were collected to estimate mortality under field conditions. Laboratory bioassays showed a mortality of 20 to 50% of the ticks seven days after inoculation with 10(7) Beauveria conidia/mL. Under field conditions 10(6) Beauveria conidia/mL induced 18-32% mortality. All Beauveria strains were effective in biological control of R. (Boophilus) microplus under laboratory and field test conditions. This is the first demonstration that endophytic fungi can be used for biological control of the cattle tick; this could help reduce environmental contamination by diminishing the need for chemical acaricides. Two endophytic strains were isolated from maize leaves and characterized by molecular sequencing of 5.8S rDNA ITS1 and ITS2 and morphological analyses of conidia. We found that these two endophytic Beauveria isolates, designated B95 and B157, are close to Beauveria amorpha.

Effect of Metarhizium anisopliae fungus on off-host Rhipicephalus (Boophilus) microplus from tick-infested pasture under cattle grazing in Brazil

Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES)

Interactions Between the Entomopathogenic Fungi Beauveria bassiana (Ascomycota: Hypocreales) and the Aphid Parasitoid Diaeretiella rapae (Hymenoptera: Braconidae) on Myzus persicae (Hemiptera: Aphididae)

The interactions between the entomopathogenic fungus Beauveria bassiana (Balsamo-Crivelli) Vuillemin (Ascomycota: Hypocreales) and the aphid parasitoid Diaeretiella rapae McIntoch (Hymenoptera: Braconidae) were evaluated under laboratory conditions. Nymphs of Myzus persicae Sulzer (Hemiptera: Aphididae) were first exposed to parasitoid females for 24 h and then 0, 24, and 48 h afterwards sprayed with a solution of B. bassiana. Likewise, aphids were also sprayed with B. bassiana and then exposed to parasitoids at 0, 24, and 48 h afterwards. Parasitism rate varied from 13 to 66.5%, and were signi_cantly lower in treatments where the two agents were exposed within a 0-24 h time interval compared with the control (without B. bassiana). Parasitoid emergence was negatively affected in treatments with B. bassiana spraying and subsequent exposure to D. rapae. Decreases in longevity of adult females of the D. rapae F1 generation were observed in treatments with B. bassiana spraying. The application of these two biological control agents can be used in combination on the control of M. persicae, wherein this use requires effective time management to avoid antagonistic interactions.

Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

Molecular detection and differentiation of Brazilian and African isolates of the entomopathogen Neozygites tanajoae (Entomophthorales: Neozygitaceae) with PCR using specific primers

Neozygites tanajoae is an entomopathogenic fungus which has been used for biocontrol of the cassava green mite (Mononychellus tanajoa, CGM) in Africa. Establishment and dispersal of Brazilian isolates which have been introduced into some African countries in recent years to improve CGM control was followed with specific PCR assays. Two primer pairs, NEOSSU_F/NEOSSU_R and 8DDC_F/8DDC_R, were used to differentiate isolates collected from several locations in Brazil and from three countries in Africa, Benin, Ghana and Tanzania. The first primer pair enabled the species-specific detection of Neozygites tanajoae, while the second differentiated the Brazilian isolates from those of other geographical origin. PCR assays were designed for detection of fungal DNA in the matrix of dead infested mites since N. tanajoae is difficult to isolate and culture on selective artificial media. Our results show that all isolates (Brazilian and African) that sporulated on mummified mites were amplified with the first primer pair confirming their Neozygites tanajoae identity. The second pair amplified DNA from all the Brazilian isolates, but did not amplify any DNA samples from the African isolates. None of the two primers showed amplification neither from any of the non-sporulating mite extracts nor from the dead uninfected mites used as negative controls. We confirmed that the two primer pairs tested are suitable for the detection and differential identification of N. tanajoae isolates from Brazil and Africa and that they are useful to monitor the establishment and spread of the Brazilian isolates of N. tanajoae introduced into Benin or into other African countries for improvement of CGM biocontrol.

Visible light during mycelial growth and conidiation of Metarhizium robertsii produces conidia with increased stress tolerance

Light conditions during mycelial growth are known to influence fungi in many ways. The effect of visible-light exposure during mycelial growth was investigated on conidial tolerance to UVB irradiation and wet heat of Metarhizium robertsii, an insect-pathogenic fungus. Two nutrient media and two light regimens were compared. Conidia were produced on (A) potato dextrose agar plus yeast extract medium (PDAY) (A1) under dark conditions or (A2) under continuous visible light (provided by two fluorescent lamps with intensity 5.4 W m-2). For comparison, the fungus was also produced on (B) minimal medium (MM) under continuous-dark incubation, which is known to produce conidia with increased tolerance to heat and UVB radiation. The UVB tolerances of conidia produced on PDAY under continuous visible light were twofold higher than conidia produced on PDAY medium under dark conditions, and this elevated UVB tolerance was similar to that of conidia produced on MM in the dark. The heat tolerance of conidia produced under continuous light was, however, similar to that of conidia produced on MM or PDAY in the dark. Conidial yield on PDAY medium was equivalent when the fungus was grown either under continuous-dark or under continuous-light conditions.

Quantification of Cyclobutane Pyrimidine Dimers Induced by UVB Radiation in Conidia of the Fungi Aspergillus fumigatus, Aspergillus nidulans, Metarhizium acridum and Metarhizium robertsii

Conidia are responsible for reproduction, dispersal, environmental persistence and host infection of many fungal species. One of the main environmental factors that can kill and/or damage conidia is solar UV radiation. Cyclobutane pyrimidine dimers (CPD) are the major DNA photoproducts induced by UVB. We examined the conidial germination kinetics and the occurrence of CPD in DNA of conidia exposed to different doses of UVB radiation. Conidia of Aspergillus fumigatus, Aspergillus nidulans and Metarhizium acridum were exposed to UVB doses of 0.9, 1.8, 3.6 and 5.4 kJ m-2. CPD were quantified using T4 endonuclease V and alkaline agarose gel electrophoresis. Most of the doses were sublethal for all three species. Exposures to UVB delayed conidial germination and the delays were directly related both to UVB doses and CPD frequencies. The frequencies of dimers also were linear and directly proportional to the UVB doses, but the CPD yields differed among species. We also evaluated the impact of conidial pigmentation on germination and CPD induction on Metarhizium robertsii. The frequency of dimers in an albino mutant was approximately 10 times higher than of its green wild-type parent strain after exposure to a sublethal dose (1.8 kJ m-2) of UVB radiation.